Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13867
Trapped Gene
Myl2 (ENSMUSG00000013936)
Vector Insertion
Chr 5: 122556864 - 122563157
Public Clones CMHD-GT_415B6-3 (cmhd) CMHD-GT_217F12-3 (cmhd) CMHD-GT_406D10-3 (cmhd) CMHD-GT_152C7-3 (cmhd)
Private Clones OST24760 (lexicon) OST24692 (lexicon) OST15681 (lexicon) OST14197 (lexicon)
OST1208 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688854 (Chr5:122556680..122556863 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688854 (Chr5:122556680..122556863 +)
Downstram Exon
ENSMUSE00000688852 (Chr5:122563158..122563481 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688851 Chr5:122550966..122551038 No primer for this exon
upstream ENSMUSE00000688867 Chr5:122550989..122551038 No primer for this exon
upstream ENSMUSE00000688853 Chr5:122550992..122551038 No primer for this exon
upstream ENSMUSE00000222492 Chr5:122551758..122551847 No primer for this exon
upstream ENSMUSE00000538154 Chr5:122552705..122552780 No primer for this exon
upstream ENSMUSE00000538153 Chr5:122553840..122553944 No primer for this exon
upstream ENSMUSE00000189067 Chr5:122554836..122554914 No primer for this exon
upstream ENSMUSE00000222472 Chr5:122554997..122555045 No primer for this exon
upstream ENSMUSE00000688850 Chr5:122554997..122555302 No primer for this exon
upstream ENSMUSE00000222465 Chr5:122556680..122556798 No primer for this exon
upstream ENSMUSE00000688854 Chr5:122556680..122556863 No primer for this exon

*** Putative Vector Insertion (Chr 5: 122556864 - 122563157) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688852 Chr5:122563158..122563481 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGTTGGTTTGTGGTCGTT Chr5:122559876..122559897 59.92 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGTTGGTTTGTGGTCGTT Chr5:122559876..122559897 59.92 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013936