Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13872
Trapped Gene
Casc1 (ENSMUSG00000043541)
Vector Insertion
Chr 6: 145123845 - 145124691
Public Clones CMHD-GT_116A5-3 (cmhd) CMHD-GT_215H7-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000515329 (Chr6:145124692..145124805 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCCCAGGTGGAGTTGAAG Chr6:145124785..145124804 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000515329 (Chr6:145124692..145124805 -)
Downstram Exon
ENSMUSE00000496941 (Chr6:145123464..145123844 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCCCAGGTGGAGTTGAAG Chr6:145124785..145124804 59.96 55 ACTTTAGCGGCTGACTGGAA Chr6:145123464..145123483 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710999 Chr6:145159327..145159490 GGCAGTACTCACCGGAAGAC Chr6:145159465..145159484 59.73 60
upstream ENSMUSE00000714517 Chr6:145159327..145159490 GGCAGTACTCACCGGAAGAC Chr6:145159465..145159484 59.73 60
upstream ENSMUSE00000688772 Chr6:145158924..145159311 CACACTCGTTGAGGGGAGAT Chr6:145159037..145159056 60.11 55
upstream ENSMUSE00000650401 Chr6:145156941..145156958 No primer for this exon
upstream ENSMUSE00000688784 Chr6:145156941..145156958 No primer for this exon
upstream ENSMUSE00000650382 Chr6:145153762..145153867 GCAGGAGGAGGAGGAGAGAC Chr6:145153777..145153796 60.49 65
upstream ENSMUSE00000650398 Chr6:145153762..145153843 GCAGGAGGAGGAGGAGAGAC Chr6:145153777..145153796 60.49 65
upstream ENSMUSE00000688782 Chr6:145153762..145153843 GCAGGAGGAGGAGGAGAGAC Chr6:145153777..145153796 60.49 65
upstream ENSMUSE00000442486 Chr6:145151457..145151548 TGGAGTCTGCTGGAAAAGAAA Chr6:145151457..145151477 59.98 42.86
upstream ENSMUSE00000650395 Chr6:145148998..145149099 TCTGCTCGAGGGTTGTTTTC Chr6:145149042..145149061 60.38 50
upstream ENSMUSE00000650393 Chr6:145145335..145145472 ACCAGGCCTTTGAACAAGTG Chr6:145145362..145145381 60.15 50
upstream ENSMUSE00000650390 Chr6:145143012..145143158 TCAGCCTGAAGATCAACGTG Chr6:145143033..145143052 59.98 50
upstream ENSMUSE00000650387 Chr6:145141322..145141425 GTGTGGGCAAACCTCAAAAA Chr6:145141331..145141350 60.9 45
upstream ENSMUSE00000483939 Chr6:145139878..145140214 TGCTCTTCGGCTTCTACACA Chr6:145140123..145140142 59.74 50
upstream ENSMUSE00000467532 Chr6:145134331..145134412 ACCACCCAACTTGAACTGGA Chr6:145134363..145134382 60.4 50
upstream ENSMUSE00000466633 Chr6:145131740..145131900 AGGTGGACTTGTGCCATTTC Chr6:145131824..145131843 59.97 50
upstream ENSMUSE00000465535 Chr6:145130279..145130435 AACCTGATCCAGACGTCACC Chr6:145130364..145130383 59.97 55
upstream ENSMUSE00000517319 Chr6:145127480..145127694 TCACGTGAACATGCCTTACC Chr6:145127566..145127585 59.57 50
upstream ENSMUSE00000514459 Chr6:145125853..145126020 CAGTGAAACTGAGGGGCAAG Chr6:145125979..145125998 60.82 55
upstream ENSMUSE00000515329 Chr6:145124692..145124805 TACCCCAGGTGGAGTTGAAG Chr6:145124785..145124804 59.96 55

*** Putative Vector Insertion (Chr 6: 145123845 - 145124691) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496941 Chr6:145123464..145123844 ACTTTAGCGGCTGACTGGAA Chr6:145123464..145123483 60.01 50
downstream ENSMUSE00000650383 Chr6:145123354..145123844 ACTTTAGCGGCTGACTGGAA Chr6:145123464..145123483 60.01 50
downstream ENSMUSE00000688771 Chr6:145123354..145126020 ACTTTAGCGGCTGACTGGAA Chr6:145123464..145123483 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGGGAGGGAGGTAATCG Chr6:145124634..145124654 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTGTGATTCGGGTAAAG Chr6:145124684..145124704 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043541