Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13874
Trapped Gene
AC105336.14 (ENSMUSG00000039887)
Vector Insertion
Chr 3: 121023130 - 121064473
Public Clones CMHD-GT_131D6-3 (cmhd) CMHD-GT_98B6-3 (cmhd) CMHD-GT_214G4-3 (cmhd)
Private Clones OST390952 (lexicon) OST366019 (lexicon) OST332682 (lexicon) OST92485 (lexicon)
OST92463 (lexicon) OST58443 (lexicon) OST42030 (lexicon) OST32506 (lexicon)
OST29111 (lexicon) OST29052 (lexicon) OST23070 (lexicon) OST22601 (lexicon)
OST20255 (lexicon) OST19330 (lexicon) OST17606 (lexicon) OST17560 (lexicon)
OST17142 (lexicon) OST14448 (lexicon) OST13938 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516823 (Chr3:121022998..121023129 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCACTGGTTCTCCGAATA Chr3:121023098..121023117 60.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516823 (Chr3:121022998..121023129 +)
Downstram Exon
ENSMUSE00000587091 (Chr3:121064474..121064936 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCACTGGTTCTCCGAATA Chr3:121023098..121023117 60.45 50 CCTGACAGGGATAGCGTCTC Chr3:121064610..121064629 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000267044 Chr3:120994691..120994901 ACTCTTGATCGTGGCTGGAT Chr3:120994879..120994898 59.69 50
upstream ENSMUSE00000267037 Chr3:121001522..121001676 TGTCCAATGCCTATTCACCA Chr3:121001561..121001580 59.92 45
upstream ENSMUSE00000516823 Chr3:121022998..121023129 TCCCACTGGTTCTCCGAATA Chr3:121023098..121023117 60.45 50

*** Putative Vector Insertion (Chr 3: 121023130 - 121064473) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000587091 Chr3:121064474..121064936 CCTGACAGGGATAGCGTCTC Chr3:121064610..121064629 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCAGGAAAGATTCCCATTT Chr3:121056121..121056142 60.17 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCAGGAAAGATTCCCATTT Chr3:121056121..121056142 60.17 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039887