Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13884
Trapped Gene
Fhit (ENSMUSG00000060579)
Vector Insertion
Chr 14: 10406026 - 10596253
Public Clones CMHD-GT_213A3-3 (cmhd)
Private Clones OST15930 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000565180 (Chr14:10596254..10596322 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCGGAATGACAACATCTA Chr14:10596261..10596280 60.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000565180 (Chr14:10596254..10596322 -)
Downstram Exon
ENSMUSE00000565178 (Chr14:10405924..10406025 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCGGAATGACAACATCTA Chr14:10596261..10596280 60.71 50 CCTGAAAGTAGACCCGCAGA Chr14:10405904..10405923 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000565183 Chr14:11254009..11254111 CTCATCAAGCCCTCTGTGGT Chr14:11254068..11254087 60.26 55
upstream ENSMUSE00000444519 Chr14:10702544..10702689 GTGGCCGATTTGTTTCAAGT Chr14:10702611..10702630 59.98 45
upstream ENSMUSE00000692685 Chr14:10702544..10702689 GTGGCCGATTTGTTTCAAGT Chr14:10702611..10702630 59.98 45
upstream ENSMUSE00000444509 Chr14:10694531..10694560 AAGCTGGGCAGACTGTGAAG Chr14:10694531..10694550 60.59 55
upstream ENSMUSE00000692683 Chr14:10694446..10694451 No primer for this exon
upstream ENSMUSE00000565180 Chr14:10596254..10596322 CCCCGGAATGACAACATCTA Chr14:10596261..10596280 60.71 50

*** Putative Vector Insertion (Chr 14: 10406026 - 10596253) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000565178 Chr14:10405924..10406025 CCTGAAAGTAGACCCGCAGA Chr14:10405904..10405923 60.39 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTGGCTTTAATCGCCTTG Chr14:10464191..10464211 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTTTCCAAAGGACGTGAC Chr14:10512196..10512217 60 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060579