Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13892
Trapped Gene
Rbpj (ENSMUSG00000039191)
Vector Insertion
Chr 5: 54018621 - 54018661
Public Clones CMHD-GT_209E4-3 (cmhd)
Private Clones OST451503 (lexicon) OST451136 (lexicon) OST365154 (lexicon) OST163104 (lexicon)
OST122023 (lexicon) OST121977 (lexicon) OST121918 (lexicon) OST119395 (lexicon)
OST65112 (lexicon) OST64331 (lexicon) OST63064 (lexicon) OST62539 (lexicon)
OST58592 (lexicon) OST54315 (lexicon) OST44187 (lexicon) OST43385 (lexicon)
OST42495 (lexicon) OST39674 (lexicon) OST38561 (lexicon) OST38325 (lexicon)
OST36166 (lexicon) OST36103 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000278782 (Chr5:54018622..54018660 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCACCCAAACGACTCACT Chr5:54018639..54018658 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000278782 (Chr5:54018622..54018660 +)
Downstram Exon
ENSMUSE00000697241 (Chr5:54018622..54018660 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCACCCAAACGACTCACT Chr5:54018639..54018658 60.15 55 AGTGAGTCGTTTGGGTGGAG Chr5:54018661..54018680 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545170 Chr5:53947018..53947142 TTAACCCGGCTTCTCAAATG Chr5:53947112..53947131 60.07 45
upstream ENSMUSE00000278790 Chr5:53981454..53981725 AGTAATGCCCTCCGGTTTTC Chr5:53981585..53981604 60.32 50
upstream ENSMUSE00000697242 Chr5:53981813..53981963 GGAGTTTTGGCGAGAGTTTG Chr5:53981918..53981937 59.85 50

*** Putative Vector Insertion (Chr 5: 54018621 - 54018661) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000278782 Chr5:54018622..54018660 AGTGAGTCGTTTGGGTGGAG Chr5:54018661..54018680 60.15 55
downstream ENSMUSE00000697241 Chr5:54018622..54018660 AGTGAGTCGTTTGGGTGGAG Chr5:54018661..54018680 60.15 55
downstream ENSMUSE00000278773 Chr5:54027201..54027296 TGTTTGATCCCCTCGTTCTT Chr5:54027246..54027265 59.53 45
downstream ENSMUSE00000697239 Chr5:54027201..54027296 TGTTTGATCCCCTCGTTCTT Chr5:54027246..54027265 59.53 45
downstream ENSMUSE00000278768 Chr5:54033263..54033428 CAATAAACGCACAGGGTTGA Chr5:54033381..54033400 59.58 45
downstream ENSMUSE00000278761 Chr5:54037109..54037283 GTCATCGCTGTTGCCATAGA Chr5:54037207..54037226 59.83 50
downstream ENSMUSE00000278753 Chr5:54040610..54040747 TAACTGTCTGGGACCGAAGG Chr5:54040672..54040691 60.1 55
downstream ENSMUSE00000278747 Chr5:54040902..54041014 TTGACAGTCTGCCCGTAATG Chr5:54040977..54040996 59.72 50
downstream ENSMUSE00000278744 Chr5:54042579..54042719 ATACAGGGTCGTCTGCATCC Chr5:54042636..54042655 59.96 55
downstream ENSMUSE00000278738 Chr5:54043846..54044001 TGTACTCGGCCTTGTCTGTG Chr5:54043936..54043955 59.9 55
downstream ENSMUSE00000278732 Chr5:54044321..54044424 GGCTTCTACATCCCCAAACC Chr5:54044413..54044432 60.69 55
downstream ENSMUSE00000405309 Chr5:54044544..54048684 GAGCGGTCAGTAGCCAGTTC Chr5:54047704..54047723 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTAGGTAATCGCCTTGCAG Chr5:54018656..54018677 59.91 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000039191