Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13893
Trapped Gene
2610029I01Rik (ENSMUSG00000028251)
Vector Insertion
Chr 4: 21686677 - 21686769
Public Clones CMHD-GT_209C2-3 (cmhd)
Private Clones OST471512 (lexicon) OST145055 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177609 (Chr4:21686770..21686940 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCAGCCAAGCATTTTGTT Chr4:21686902..21686921 60.65 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177609 (Chr4:21686770..21686940 -)
Downstram Exon
ENSMUSE00000177610 (Chr4:21686517..21686676 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCAGCCAAGCATTTTGTT Chr4:21686902..21686921 60.65 40 CCAGACGGTCAGATTTGGAT Chr4:21686565..21686584 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000240815 Chr4:21694197..21694344 AGAGAGCCCATTGTGATGCT Chr4:21694262..21694281 59.83 50
upstream ENSMUSE00000177609 Chr4:21686770..21686940 ATGCAGCCAAGCATTTTGTT Chr4:21686902..21686921 60.65 40

*** Putative Vector Insertion (Chr 4: 21686677 - 21686769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000177610 Chr4:21686517..21686676 CCAGACGGTCAGATTTGGAT Chr4:21686565..21686584 59.93 50
downstream ENSMUSE00000177612 Chr4:21684530..21685622 ACCGTGATGACACATGGCTA Chr4:21685013..21685032 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAATTCTTGAGCAAGGAAAA Chr4:21686793..21686815 59.72 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTGACGTGACTGGGAAAAC Chr4:21686703..21686724 59.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028251