Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13894
Trapped Gene
Rilpl1 (ENSMUSG00000029392)
Vector Insertion
Chr 5: 124943854 - 124951848
Public Clones CMHD-GT_209A4-3 (cmhd) CMHD-GT_488E10-3 (cmhd) CMHD-GT_515D9-3 (cmhd) IST14488E2 (tigm)
Private Clones OST345566 (lexicon) OST312134 (lexicon) OST248366 (lexicon) OST28251 (lexicon)
OST22523 (lexicon) OST14226 (lexicon) OST14182 (lexicon) OST7403 (lexicon)
OST2310 (lexicon) OST1133 (lexicon) OST730 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322393 (Chr5:124951849..124951941 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322393 (Chr5:124951849..124951941 -)
Downstram Exon
ENSMUSE00000322382 (Chr5:124943091..124943853 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGTCATCAGTCCTCAAAGCA Chr5:124943590..124943609 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714561 Chr5:124980684..124981400 AGAGGGTCATCGACCAACAC Chr5:124980858..124980877 59.97 55
upstream ENSMUSE00000718542 Chr5:124980684..124981400 AGAGGGTCATCGACCAACAC Chr5:124980858..124980877 59.97 55
upstream ENSMUSE00000188493 Chr5:124971260..124971410 CAGCTGATGACCAACCTCAA Chr5:124971307..124971326 59.83 50
upstream ENSMUSE00000687885 Chr5:124971260..124971410 CAGCTGATGACCAACCTCAA Chr5:124971307..124971326 59.83 50
upstream ENSMUSE00000188495 Chr5:124965527..124965645 GGTGATGAAGAGGCTGAAGG Chr5:124965604..124965623 59.8 55
upstream ENSMUSE00000687884 Chr5:124965527..124965645 GGTGATGAAGAGGCTGAAGG Chr5:124965604..124965623 59.8 55
upstream ENSMUSE00000322403 Chr5:124964528..124964752 AAAGCCCTGATTGAGCAGAA Chr5:124964655..124964674 59.96 45
upstream ENSMUSE00000687883 Chr5:124964528..124964752 AAAGCCCTGATTGAGCAGAA Chr5:124964655..124964674 59.96 45
upstream ENSMUSE00000687882 Chr5:124953686..124953742 GGAATCGATTTCAGATGCAGA Chr5:124953699..124953719 60.17 42.86
upstream ENSMUSE00000687880 Chr5:124953672..124953683 No primer for this exon
upstream ENSMUSE00000687879 Chr5:124953616..124953669 No primer for this exon
upstream ENSMUSE00000322397 Chr5:124953564..124953742 AGGAACGAGCTCAAGTCCAA Chr5:124953603..124953622 59.99 50
upstream ENSMUSE00000687878 Chr5:124953560..124953613 TGCAAGAGGAACTGGCCTAC Chr5:124953572..124953591 60.4 55
upstream ENSMUSE00000322393 Chr5:124951849..124951941 No primer for this exon

*** Putative Vector Insertion (Chr 5: 124943854 - 124951848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000322382 Chr5:124943091..124943853 CGTCATCAGTCCTCAAAGCA Chr5:124943590..124943609 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTTGGCAGCTGTTTGGTT Chr5:124951801..124951821 60.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTTGGCAGCTGTTTGGTT Chr5:124951801..124951821 60.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCATCTCTGGGTCTCTGCTC Chr5:124948970..124948990 60.1 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTACACGTGACTGGGAAAACC Chr5:124951875..124951896 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029392