Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13898
Trapped Gene
4921525H12Rik (ENSMUSG00000049565)
Vector Insertion
Chr 3: 108568156 - 108574827
Public Clones CMHD-GT_202.1G4-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393577 (Chr3:108568028..108568155 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGAACATGCTGGCAGTCT Chr3:108568034..108568053 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393577 (Chr3:108568028..108568155 +)
Downstram Exon
ENSMUSE00000409034 (Chr3:108574828..108574925 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGAACATGCTGGCAGTCT Chr3:108568034..108568053 59.87 50 AGTTCTTCTGTGGCCCCTTT Chr3:108574867..108574886 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670623 Chr3:108542576..108542770 GTGATGTCGGGACCCTAAGA Chr3:108542746..108542765 59.93 55
upstream ENSMUSE00000708917 Chr3:108554468..108555567 CATGGACGAAACCGACTTTT Chr3:108554589..108554608 59.97 45
upstream ENSMUSE00000720464 Chr3:108554468..108555567 CATGGACGAAACCGACTTTT Chr3:108554589..108554608 59.97 45
upstream ENSMUSE00000636491 Chr3:108559374..108559413 ACACACCTGCCAAGAACCTC Chr3:108559388..108559407 60.16 55
upstream ENSMUSE00000636496 Chr3:108559374..108559413 ACACACCTGCCAAGAACCTC Chr3:108559388..108559407 60.16 55
upstream ENSMUSE00000636490 Chr3:108559659..108559804 TGCTTGAATTTGACACCAACA Chr3:108559679..108559699 60.14 38.1
upstream ENSMUSE00000636495 Chr3:108559659..108559804 TGCTTGAATTTGACACCAACA Chr3:108559679..108559699 60.14 38.1
upstream ENSMUSE00000373500 Chr3:108560159..108560221 TTCTGCCATTTGCAAGACAT Chr3:108560195..108560214 59.28 40
upstream ENSMUSE00000636489 Chr3:108560159..108560305 AAATGCAGAGAGGCTTTCCA Chr3:108560273..108560292 59.96 45
upstream ENSMUSE00000670622 Chr3:108563256..108563273 No primer for this exon
upstream ENSMUSE00000393577 Chr3:108568028..108568155 AAGGAACATGCTGGCAGTCT Chr3:108568034..108568053 59.87 50

*** Putative Vector Insertion (Chr 3: 108568156 - 108574827) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409034 Chr3:108574828..108574925 AGTTCTTCTGTGGCCCCTTT Chr3:108574867..108574886 60.11 50
downstream ENSMUSE00000348441 Chr3:108577895..108578017 CTTGCTTCCGTAGGCTTCAC Chr3:108577977..108577996 60.01 55
downstream ENSMUSE00000587521 Chr3:108578104..108578211 AGAAGTGAGGCTGGACAAAGA Chr3:108578186..108578206 59.08 47.62
downstream ENSMUSE00000587520 Chr3:108581144..108581222 CAGGACCAGATCCATTTTGC Chr3:108581177..108581196 60.46 50
downstream ENSMUSE00000587519 Chr3:108584039..108584168 GGTGTTGCAAGGTCTGAGGT Chr3:108584089..108584108 60.16 55
downstream ENSMUSE00000636493 Chr3:108584835..108585214 TAAATGCCAGAGGGCTTGTT Chr3:108585142..108585161 59.71 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGGAGGCTGAAACTACACA Chr3:108574132..108574152 61.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGGAGGCTGAAACTACACA Chr3:108574132..108574152 61.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049565