Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13904
Trapped Gene
Pak7 (ENSMUSG00000039913)
Vector Insertion
Chr 2: 135907634 - 135909113
Public Clones CMHD-GT_194B11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000403605 (Chr2:135907635..135909112 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCAGCTGATTGGTGGAAC Chr2:135908840..135908859 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000403605 (Chr2:135907635..135909112 -)
Downstram Exon
ENSMUSE00000473336 (Chr2:135907633..135909112 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCAGCTGATTGGTGGAAC Chr2:135908840..135908859 59.97 50 TTTGCCTAGCTTTGCATCCT Chr2:135908903..135908922 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000338139 Chr2:136213390..136213674 GAGGTACCGCGACTTCTCTG Chr2:136213408..136213427 60.01 60
upstream ENSMUSE00000682773 Chr2:136213390..136213696 GAGGTACCGCGACTTCTCTG Chr2:136213408..136213427 60.01 60
upstream ENSMUSE00000414319 Chr2:136159104..136159223 GGCTCTTCAGCCACTAGCAC Chr2:136159146..136159165 60.16 60
upstream ENSMUSE00000332466 Chr2:136095059..136095213 CGGCCTTCGTAAAACAAAAA Chr2:136095059..136095078 60.1 40
upstream ENSMUSE00000406839 Chr2:135999797..136000011 ATGCATCACACCCATACAGC Chr2:135999811..135999830 59.4 50
upstream ENSMUSE00000710225 Chr2:135999797..136000011 ATGCATCACACCCATACAGC Chr2:135999811..135999830 59.4 50
upstream ENSMUSE00000290793 Chr2:135941913..135942698 ATTCCAGCTCACGCCTTCTA Chr2:135942191..135942210 59.98 50
upstream ENSMUSE00000290783 Chr2:135926473..135926964 CATCCCTGCAAACCAGTTCT Chr2:135926779..135926798 60.11 50
upstream ENSMUSE00000557953 Chr2:135924013..135924146 AAGGTGGTGCCTTGACAGAC Chr2:135924030..135924049 60.16 55
upstream ENSMUSE00000290766 Chr2:135923207..135923333 CATTCTTCTGACAAGCGATGG Chr2:135923211..135923231 60.78 47.62
upstream ENSMUSE00000290759 Chr2:135913129..135913254 CCAGGCTACCTTATGGGACA Chr2:135913132..135913151 59.95 55
upstream ENSMUSE00000557950 Chr2:135911283..135911417 GGATCCGGGACAGTTTACCT Chr2:135911307..135911326 60.19 55
upstream ENSMUSE00000403605 Chr2:135907635..135909112 AACCAGCTGATTGGTGGAAC Chr2:135908840..135908859 59.97 50

*** Putative Vector Insertion (Chr 2: 135907634 - 135909113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473336 Chr2:135907633..135909112 TTTGCCTAGCTTTGCATCCT Chr2:135908903..135908922 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000039913