Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13905
Trapped Gene
6620401K05Rik (ENSMUSG00000025646)
Vector Insertion
Chr 9: 108963027 - 108963142
Public Clones CMHD-GT_190H7-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314247 (Chr9:108963143..108963223 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCATTGGTTCTGACTGT Chr9:108963158..108963177 58.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314247 (Chr9:108963143..108963223 -)
Downstram Exon
ENSMUSE00000314236 (Chr9:108962777..108963026 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCATTGGTTCTGACTGT Chr9:108963158..108963177 58.72 50 TCACCTGGTCGTACTGATGC Chr9:108962809..108962828 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344489 Chr9:108976269..108976625 GTGAGCACGCGGAATTTACT Chr9:108976348..108976367 60.28 50
upstream ENSMUSE00000385273 Chr9:108975121..108975251 CTCATAAGGTCCGCCGATTA Chr9:108975229..108975248 60.05 50
upstream ENSMUSE00000314170 Chr9:108974232..108974402 GCGTCAGACAGAATCCGTTC Chr9:108974318..108974337 60.81 55
upstream ENSMUSE00000314147 Chr9:108971793..108971911 AGAGCAACGGACGAACAAAT Chr9:108971825..108971844 59.74 45
upstream ENSMUSE00000314362 Chr9:108970267..108970424 TGCTAACACGCCTCTCTTCC Chr9:108970315..108970334 60.54 55
upstream ENSMUSE00000401692 Chr9:108969531..108969632 GCAAGATGTGCAGCAGAGAA Chr9:108969570..108969589 60.3 50
upstream ENSMUSE00000314315 Chr9:108968480..108968606 GGTTCCTACTGGCACCCTCT Chr9:108968499..108968518 60.51 60
upstream ENSMUSE00000314297 Chr9:108967642..108968313 TCATGGCTTGGAGAGCTTTT Chr9:108967952..108967971 59.96 45
upstream ENSMUSE00000314279 Chr9:108964046..108964182 CTGGACCATGACAGCCTAGC Chr9:108964069..108964088 60.82 60
upstream ENSMUSE00000314264 Chr9:108963624..108963715 CATCACATCAAGGCCTGACA Chr9:108963665..108963684 60.69 50
upstream ENSMUSE00000314247 Chr9:108963143..108963223 CTGGCATTGGTTCTGACTGT Chr9:108963158..108963177 58.72 50

*** Putative Vector Insertion (Chr 9: 108963027 - 108963142) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314236 Chr9:108962777..108963026 TCACCTGGTCGTACTGATGC Chr9:108962809..108962828 59.71 55
downstream ENSMUSE00000344333 Chr9:108962263..108962422 CAGGCCCTCAGTTACAGTCC Chr9:108962326..108962345 59.72 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCATTGGTTCTGACTGT Chr9:108963156..108963176 58.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCAATCGTGACTGGGAAA Chr9:108963078..108963098 61.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025646