Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13909
Trapped Gene
Mrpl41 (ENSMUSG00000036850)
Vector Insertion
Chr 2: 24830202 - 24830407
Public Clones CMHD-GT_182F3-3 (cmhd) CMHD-GT_139A5-3 (cmhd) CMHD-GT_190A2-3 (cmhd) CMHD-GT_391C11-3 (cmhd)
Private Clones OST40455 (lexicon) OST28451 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000353639 (Chr2:24830408..24830557 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTTTTAAACGGCTCAGG Chr2:24830494..24830513 59.61 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000353639 (Chr2:24830408..24830557 -)
Downstram Exon
ENSMUSE00000245553 (Chr2:24829640..24830201 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTTTTAAACGGCTCAGG Chr2:24830494..24830513 59.61 50 AGAAGTGCGCTAGGAAGCTG Chr2:24829641..24829660 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353639 Chr2:24830408..24830557 GGTGTTTTAAACGGCTCAGG Chr2:24830494..24830513 59.61 50

*** Putative Vector Insertion (Chr 2: 24830202 - 24830407) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000245553 Chr2:24829640..24830201 AGAAGTGCGCTAGGAAGCTG Chr2:24829641..24829660 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTCTCCCTTTCTCCCTTG Chr2:24830435..24830455 60.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCTCCCTTTCTCCCTTG Chr2:24830435..24830455 60.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036850