Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13926
Trapped Gene
Ndufb6 (ENSMUSG00000071014)
Vector Insertion
Chr 4: 40219888 - 40224685
Public Clones CMHD-GT_185F8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000605102 (Chr4:40224686..40224778 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTACCGCTCCAGTCTCTTC Chr4:40224749..40224768 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000605102 (Chr4:40224686..40224778 -)
Downstram Exon
ENSMUSE00000633016 (Chr4:40219843..40219887 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTACCGCTCCAGTCTCTTC Chr4:40224749..40224768 60.01 60 CTGGGCTTCGAGCTAACAAT Chr4:40219831..40219850 59.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605103 Chr4:40226191..40226401 TGGAGCGATTCTGGGATAAC Chr4:40226224..40226243 60.04 50
upstream ENSMUSE00000605102 Chr4:40224686..40224778 CGTACCGCTCCAGTCTCTTC Chr4:40224749..40224768 60.01 60

*** Putative Vector Insertion (Chr 4: 40219888 - 40224685) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000633016 Chr4:40219843..40219887 CTGGGCTTCGAGCTAACAAT Chr4:40219831..40219850 59.48 50
downstream ENSMUSE00000605101 Chr4:40217696..40217880 GGAAAATCTCTCATTGGTGGA Chr4:40217806..40217826 58.97 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr4:40224615..40224635 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTATCCGTGACTGGGAAAACC Chr4:40224618..40224641 61.25 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071014