Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13929
Trapped Gene
1700112C13Rik (ENSMUSG00000049719)
Vector Insertion
Chr 9: 110753983 - 110758503
Public Clones CMHD-GT_385C10-3 (cmhd) CMHD-GT_170C12-3 (cmhd) CMHD-GT_404C4-3 (cmhd)
Private Clones OST61591 (lexicon) OST27606 (lexicon) OST21726 (lexicon) OST18563 (lexicon)
OST17131 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220137 (Chr9:110753819..110753982 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTTTGGCTGTCAGGATTG Chr9:110753847..110753866 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220137 (Chr9:110753819..110753982 +)
Downstram Exon
ENSMUSE00000715516 (Chr9:110758504..110759020 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTTTGGCTGTCAGGATTG Chr9:110753847..110753866 60.11 50 CATCTGGACCCAGGTCTTGT Chr9:110758560..110758579 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583134 Chr9:110747010..110747138 CAGTGGATCCTCACGGTCTT Chr9:110747067..110747086 60.11 55
upstream ENSMUSE00000715741 Chr9:110752042..110752308 ACCTGCAAGGTGGTAAATGG Chr9:110752166..110752185 59.85 50
upstream ENSMUSE00000348778 Chr9:110752131..110752308 GCAAGGTGGTAAATGGGAAG Chr9:110752170..110752189 59.43 50
upstream ENSMUSE00000391531 Chr9:110752500..110752762 ATCAATCGCATGTCTGACGA Chr9:110752606..110752625 60.23 45
upstream ENSMUSE00000220137 Chr9:110753819..110753982 AGGTTTGGCTGTCAGGATTG Chr9:110753847..110753866 60.11 50

*** Putative Vector Insertion (Chr 9: 110753983 - 110758503) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000406701 Chr9:110758504..110759026 CATCTGGACCCAGGTCTTGT Chr9:110758560..110758579 59.96 55
downstream ENSMUSE00000715516 Chr9:110758504..110759020 CATCTGGACCCAGGTCTTGT Chr9:110758560..110758579 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACATGTTGTGTACAAGCTCA Chr9:110753938..110753960 59.83 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAATGGGGCCTGGACACTT Chr9:110753959..110753979 63.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049719