Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13932
Trapped Gene
Sgca (ENSMUSG00000001508)
Vector Insertion
Chr 11: 94824714 - 94830372
Public Clones CMHD-GT_415G12-3 (cmhd) CMHD-GT_169B1-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000476578 (Chr11:94830373..94830399 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000476578 (Chr11:94830373..94830399 -)
Downstram Exon
ENSMUSE00000661441 (Chr11:94824516..94824713 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661443 Chr11:94837429..94837641 No primer for this exon
upstream ENSMUSE00000648661 Chr11:94834716..94834764 No primer for this exon
upstream ENSMUSE00000661442 Chr11:94834716..94834792 No primer for this exon
upstream ENSMUSE00000577672 Chr11:94833806..94833925 No primer for this exon
upstream ENSMUSE00000674337 Chr11:94833528..94833682 No primer for this exon
upstream ENSMUSE00000110783 Chr11:94833284..94833356 No primer for this exon
upstream ENSMUSE00000110787 Chr11:94832555..94832753 No primer for this exon
upstream ENSMUSE00000110785 Chr11:94831985..94832147 No primer for this exon
upstream ENSMUSE00000110782 Chr11:94830668..94830876 No primer for this exon
upstream ENSMUSE00000476578 Chr11:94830373..94830399 No primer for this exon

*** Putative Vector Insertion (Chr 11: 94824714 - 94830372) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661441 Chr11:94824516..94824713 No primer for this exon
downstream ENSMUSE00000674331 Chr11:94824106..94824394 No primer for this exon
downstream ENSMUSE00000648652 Chr11:94824105..94824394 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGGATTTAATCGCCTTGC Chr11:94827309..94827329 60.17 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAAACACGTGACTGGGAAA Chr11:94827308..94827329 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001508