Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13939
Trapped Gene
Rps27l (ENSMUSG00000036781)
Vector Insertion
Chr 9: 66793988 - 66794637
Public Clones (sanger) D102G03 (ggtc) CMHD-GT_167F8-3 (cmhd) CMHD-GT_167G8-3 (cmhd)
CMHD-GT_378F4-3 (cmhd) PST17272-NL (escells) IST14373A7 (tigm)
Private Clones OST471436 (lexicon) OST190500 (lexicon) OST164878 (lexicon) OST58895 (lexicon)
OST27895 (lexicon) OST27888 (lexicon) OST23004 (lexicon) OST18019 (lexicon)
OST16172 (lexicon) OST10610 (lexicon) OST7458 (lexicon) OST1789 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000340744 (Chr9:66793907..66793987 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGAAAGCGAGCAGTTCGT Chr9:66793922..66793941 63.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000340744 (Chr9:66793907..66793987 +)
Downstram Exon
ENSMUSE00000240972 (Chr9:66794638..66794746 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGAAAGCGAGCAGTTCGT Chr9:66793922..66793941 63.06 55 TGAACCAGCCGTTTCTTCTT Chr9:66794711..66794730 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340744 Chr9:66793907..66793987 CTCGAAAGCGAGCAGTTCGT Chr9:66793922..66793941 63.06 55

*** Putative Vector Insertion (Chr 9: 66793988 - 66794637) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240972 Chr9:66794638..66794746 TGAACCAGCCGTTTCTTCTT Chr9:66794711..66794730 59.85 45
downstream ENSMUSE00000240947 Chr9:66795394..66795504 TGGCACAACACAGTTGAACA Chr9:66795475..66795494 59.75 45
downstream ENSMUSE00000398331 Chr9:66797136..66797319 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCACCATGCCCGTAAGTTT Chr9:66793977..66793997 59.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCACCATGCCCGTAAGTTT Chr9:66793977..66793997 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036781