Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13945
Trapped Gene
Defb5 (ENSMUSG00000039785)
Vector Insertion
Chr 8: 19250695 - 19250829
Public Clones CMHD-GT_165A3-3 (cmhd) CMHD-GT_389H2-3 (cmhd) CMHD-GT_134F10-3 (cmhd) CMHD-GT_416G6-3 (cmhd)
CMHD-GT_152H4-3 (cmhd) CMHD-GT_140C12-3 (cmhd) CMHD-GT_415C11-3 (cmhd) CMHD-GT_143D3-3 (cmhd)
CMHD-GT_439D2-3 (cmhd)
Private Clones OST27416 (lexicon) OST3508 (lexicon) OST2166 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718256 (Chr8:19250696..19250828 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGTGCAAGGGCAACATT Chr8:19250755..19250774 60.53 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718256 (Chr8:19250696..19250828 +)
Downstram Exon
ENSMUSE00000711448 (Chr8:19250696..19250828 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGTGCAAGGGCAACATT Chr8:19250755..19250774 60.53 45 AATGTTGCCCTTGCACAGAT Chr8:19250777..19250796 60.53 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685266 Chr8:19247580..19247653 CAGGCTTCAGCCATGAAGAT Chr8:19247580..19247599 60.36 50
upstream ENSMUSE00000225796 Chr8:19247592..19247649 ATTTCTCCTGGTGCTGCTGT Chr8:19247618..19247637 59.87 50
upstream ENSMUSE00000685268 Chr8:19249842..19249845 No primer for this exon

*** Putative Vector Insertion (Chr 8: 19250695 - 19250829) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711448 Chr8:19250696..19250828 AATGTTGCCCTTGCACAGAT Chr8:19250777..19250796 60.53 45
downstream ENSMUSE00000718256 Chr8:19250696..19250828 AATGTTGCCCTTGCACAGAT Chr8:19250777..19250796 60.53 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACCTGGCACTTTCAATTC Chr8:19250646..19250666 58.7 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATGATTGGAGGCCGTGAC Chr8:19250732..19250752 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039785