Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13946
Trapped Gene
Gdpd3 (ENSMUSG00000030703)
Vector Insertion
Chr 7: 133914728 - 133918967
Public Clones CMHD-GT_164B9-3 (cmhd) CMHD-GT_153G11-3 (cmhd)
Private Clones OST4822 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000202163 (Chr7:133914676..133914727 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCTGATCCGACACTTGCAG Chr7:133914693..133914712 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000202163 (Chr7:133914676..133914727 +)
Downstram Exon
ENSMUSE00000486379 (Chr7:133918968..133919157 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCTGATCCGACACTTGCAG Chr7:133914693..133914712 59.42 55 AGCTGAAGGCCACTTCAAAA Chr7:133919022..133919041 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294346 Chr7:133909928..133910123 AGCGAGGCTATGATCCCTCT Chr7:133909976..133909995 60.34 55
upstream ENSMUSE00000294340 Chr7:133910416..133910458 GAGCGACTGGAGAACACCAT Chr7:133910424..133910443 60.27 55
upstream ENSMUSE00000294331 Chr7:133910689..133910824 AATTTGACTGCCAGCTCACC Chr7:133910718..133910737 60.26 50
upstream ENSMUSE00000202169 Chr7:133910905..133910950 CTGCCCCTCTACAAGGAAGA Chr7:133910908..133910927 59.42 55
upstream ENSMUSE00000202168 Chr7:133911081..133911199 TCAGACCGGCACATGATTAG Chr7:133911098..133911117 59.67 50
upstream ENSMUSE00000202166 Chr7:133911277..133911366 AACCTGACTAGGCGCTTTGA Chr7:133911283..133911302 60.01 50
upstream ENSMUSE00000202158 Chr7:133912084..133912217 ATGGCGATCGTTCTGGATAC Chr7:133912113..133912132 59.92 50
upstream ENSMUSE00000202165 Chr7:133914502..133914561 ACCAACTGTCGGCTACCATT Chr7:133914534..133914553 59.48 50
upstream ENSMUSE00000202163 Chr7:133914676..133914727 GTCTGATCCGACACTTGCAG Chr7:133914693..133914712 59.42 55

*** Putative Vector Insertion (Chr 7: 133914728 - 133918967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000486379 Chr7:133918968..133919157 AGCTGAAGGCCACTTCAAAA Chr7:133919022..133919041 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGATCCGACACTTGCAG Chr7:133914694..133914714 59.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGTACGCCTCGTGACTGG Chr7:133914768..133914788 61.33 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030703