Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1396
Trapped Gene
Raet1c (ENSMUSG00000053219)
Vector Insertion
Chr 10: 21878525 - 21891809
Public Clones CJ0023 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666560 (Chr10:21878375..21878524 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCGCTGTAGTCAGTTACC Chr10:21878429..21878448 59.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666560 (Chr10:21878375..21878524 +)
Downstram Exon
ENSMUSE00000666559 (Chr10:21891810..21891907 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCGCTGTAGTCAGTTACC Chr10:21878429..21878448 59.76 60 TGCTTATGTGCCATTTGGTC Chr10:21891856..21891875 59.55 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666560 Chr10:21878375..21878524 GGCCGCTGTAGTCAGTTACC Chr10:21878429..21878448 59.76 60

*** Putative Vector Insertion (Chr 10: 21878525 - 21891809) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666559 Chr10:21891810..21891907 TGCTTATGTGCCATTTGGTC Chr10:21891856..21891875 59.55 45
downstream ENSMUSE00000666558 Chr10:21892987..21893056 GATTCCAGGCAGGTTTCTGA Chr10:21893021..21893040 60.19 50
downstream ENSMUSE00000644608 Chr10:21893327..21893342 No primer for this exon
downstream ENSMUSE00000615544 Chr10:21893682..21893772 TCTTGAACTGCAGCCTCTGA Chr10:21893707..21893726 59.85 50
downstream ENSMUSE00000436736 Chr10:21893725..21893772 TGGCAATAGTGTCAGGAAAGG Chr10:21893749..21893769 60.12 47.62
downstream ENSMUSE00000644606 Chr10:21894099..21894216 GCCCGTTGGTGTATCCATAG Chr10:21894213..21894232 60.21 55
downstream ENSMUSE00000436717 Chr10:21900424..21900678 TCCACTGAGCACTTCACGTC Chr10:21900511..21900530 60.03 55
downstream ENSMUSE00000644602 Chr10:21900931..21901194 TGTCTGCATTGGGGTATGAA Chr10:21901156..21901175 59.92 45
downstream ENSMUSE00000644600 Chr10:21901752..21901921 GAAGCGGGGAAGTTGATGTA Chr10:21901808..21901827 60.07 50
downstream ENSMUSE00000436481 Chr10:21903361..21903720 GCTGTATTGCCTGGCATTTT Chr10:21903699..21903718 60.1 45
downstream ENSMUSE00000615542 Chr10:21903361..21903584 GGACTTGCCCTGGGTTTAAT Chr10:21903548..21903567 60.19 50
downstream ENSMUSE00000615535 Chr10:22093583..22093945 TGGACGTCCTCCATCATACA Chr10:22093889..22093908 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACAGACACTCCAGCTTCG Chr10:21878479..21878499 58.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACAGACACTCCAGCTTCG Chr10:21878479..21878499 58.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053219