Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13965
Trapped Gene
2010316F05Rik (ENSMUSG00000032673)
Vector Insertion
Chr 11: 29412882 - 29413677
Public Clones CMHD-GT_146B3-3 (cmhd) CMHD-GT_165A9-3 (cmhd) CMHD-GT_84G1-3 (cmhd) CMHD-GT_167E9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680443 (Chr11:29412883..29413676 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTCTTCTGCGATGATGGA Chr11:29413413..29413432 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680443 (Chr11:29412883..29413676 -)
Downstram Exon
ENSMUSE00000371491 (Chr11:29412883..29413676 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTCTTCTGCGATGATGGA Chr11:29413413..29413432 59.94 50 CCATCATCGCAGAAGAGTGA Chr11:29413392..29413411 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713169 Chr11:29414917..29415006 TGCGGGCTGAGTTAGAACAG Chr11:29414965..29414984 61.5 55
upstream ENSMUSE00000720315 Chr11:29414917..29415006 TGCGGGCTGAGTTAGAACAG Chr11:29414965..29414984 61.5 55
upstream ENSMUSE00000680444 Chr11:29414432..29414522 No primer for this exon
upstream ENSMUSE00000371491 Chr11:29412883..29413676 CACTCTTCTGCGATGATGGA Chr11:29413413..29413432 59.94 50
upstream ENSMUSE00000680443 Chr11:29412883..29413676 CACTCTTCTGCGATGATGGA Chr11:29413413..29413432 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr11:29413607..29413627 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGAAAGGAGCGTGACTGG Chr11:29413617..29413637 61.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032673