Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13974
Trapped Gene
Zmat4 (ENSMUSG00000037492)
Vector Insertion
Chr 8: 25125685 - 25170217
Public Clones (sanger) D065G08 (ggtc) D065G07 (ggtc) CMHD-GT_147B1-3 (cmhd) IST14512B10 (tigm)
IST14906E1 (tigm) IST14125C11 (tigm) IST14629F4 (tigm)
Private Clones OST326150 (lexicon) OST251754 (lexicon) OST174420 (lexicon) OST132593 (lexicon)
OST126337 (lexicon) OST70996 (lexicon) OST66715 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000256212 (Chr8:25125588..25125684 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCAGTGTGTCGCTCAACT Chr8:25125616..25125635 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000256212 (Chr8:25125588..25125684 +)
Downstram Exon
ENSMUSE00000523322 (Chr8:25170218..25173575 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCAGTGTGTCGCTCAACT Chr8:25125616..25125635 60.1 55 GTTTCCGTGTCGTTTCGTTT Chr8:25171500..25171519 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523323 Chr8:24780135..24780273 GAAAGGTCTGGTCGCAGAGA Chr8:24780152..24780171 60.53 55
upstream ENSMUSE00000256283 Chr8:24858872..24858977 No primer for this exon
upstream ENSMUSE00000256277 Chr8:24907814..24907903 CAGCAAAGTCCGGCTGTATT Chr8:24907828..24907847 60.27 50
upstream ENSMUSE00000256234 Chr8:25012487..25012643 TCCACGCCAAAAGGTTAAAA Chr8:25012587..25012606 60.46 40
upstream ENSMUSE00000256225 Chr8:25039568..25039795 GCTAGAGCAGCTCGGAACAT Chr8:25039752..25039771 59.75 55
upstream ENSMUSE00000256212 Chr8:25125588..25125684 GTGCAGTGTGTCGCTCAACT Chr8:25125616..25125635 60.1 55

*** Putative Vector Insertion (Chr 8: 25125685 - 25170217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000523322 Chr8:25170218..25173575 GTTTCCGTGTCGTTTCGTTT Chr8:25171500..25171519 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGACTGTGCTCTGGTTCC Chr8:25164661..25164681 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGACTGTGCTCTGGTTCC Chr8:25164661..25164681 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037492