Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13977
Trapped Gene
B2m (ENSMUSG00000060802)
Vector Insertion
Chr 2: 121976888 - 121977382
Public Clones CMHD-GT_133B6-3 (cmhd)
Private Clones OST444744 (lexicon) OST320347 (lexicon) OST231053 (lexicon) OST222461 (lexicon)
OST218929 (lexicon) OST202957 (lexicon) OST168233 (lexicon) OST110819 (lexicon)
OST60053 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661693 (Chr2:121976609..121976887 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGGAAGCCGAACATACTG Chr2:121976651..121976670 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661693 (Chr2:121976609..121976887 +)
Downstram Exon
ENSMUSE00000661692 (Chr2:121977383..121977411 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGGAAGCCGAACATACTG Chr2:121976651..121976670 59.96 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661694 Chr2:121973422..121973540 CTGACCGGCCTGTATGCTAT Chr2:121973516..121973535 60.12 55
upstream ENSMUSE00000661693 Chr2:121976609..121976887 ATGGGAAGCCGAACATACTG Chr2:121976651..121976670 59.96 50

*** Putative Vector Insertion (Chr 2: 121976888 - 121977382) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661692 Chr2:121977383..121977411 No primer for this exon
downstream ENSMUSE00000661691 Chr2:121978387..121978610 GCTATTTCTTTCTGCGTGCAT Chr2:121978471..121978491 59.51 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGCTCCATCTGTGTGGACT Chr2:121976919..121976939 60.75 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACTCGTGACTGGGAAAAC Chr2:121976934..121976954 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060802