Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13978
Trapped Gene
Ifitm1 (ENSMUSG00000025491)
Vector Insertion
Chr 7: 148154338 - 148155387
Public Clones (sanger) CMHD-GT_133A8-3 (cmhd) CMHD-GT_389H5-3 (cmhd) IST13614G10 (tigm)
IST13082G3 (tigm) IST13082G3 (tigm) IST12426E9 (tigm) IST12426E9 (tigm)
Private Clones OST417676 (lexicon) OST404376 (lexicon) OST398716 (lexicon) OST353561 (lexicon)
OST316022 (lexicon) OST306743 (lexicon) OST242195 (lexicon) OST230713 (lexicon)
OST218207 (lexicon) OST192951 (lexicon) OST146539 (lexicon) OST96752 (lexicon)
OST63923 (lexicon) OST27726 (lexicon) OST20978 (lexicon) OST13373 (lexicon)
OST8086 (lexicon) OST5543 (lexicon)
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151124 (Chr7:148154131..148154337 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCAAAAGCCGAGAGATGC Chr7:148154139..148154158 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151124 (Chr7:148154131..148154337 +)
Downstram Exon
ENSMUSE00000668378 (Chr7:148155388..148155717 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCAAAAGCCGAGAGATGC Chr7:148154139..148154158 60.1 50 AATGGCACAGACAACGATGA Chr7:148155522..148155541 60.12 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668380 Chr7:148153120..148153465 CCCAACGGACCTCTGTAGAA Chr7:148153330..148153349 60.1 55
upstream ENSMUSE00000668375 Chr7:148153927..148153950 No primer for this exon
upstream ENSMUSE00000151124 Chr7:148154131..148154337 CTTCAAAAGCCGAGAGATGC Chr7:148154139..148154158 60.1 50
upstream ENSMUSE00000668379 Chr7:148154139..148154337 CTTCAAAAGCCGAGAGATGC Chr7:148154139..148154158 60.1 50

*** Putative Vector Insertion (Chr 7: 148154338 - 148155387) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151125 Chr7:148155388..148155724 AATGGCACAGACAACGATGA Chr7:148155522..148155541 60.12 45
downstream ENSMUSE00000668378 Chr7:148155388..148155717 AATGGCACAGACAACGATGA Chr7:148155522..148155541 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATGGGCCTCAACCTTGACT Chr7:148154345..148154365 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGGGCCTCAACCTTGACT Chr7:148154345..148154365 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025491