Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13980
Trapped Gene
Gabrp (ENSMUSG00000020159)
Vector Insertion
Chr 11: 33452843 - 33454293
Public Clones CMHD-GT_180G11-3 (cmhd) IST14981H5 (tigm) IST12313A8 (tigm) IST14981H5 (tigm)
IST12313A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101273 (Chr11:33454294..33454481 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101273 (Chr11:33454294..33454481 -)
Downstram Exon
ENSMUSE00000408067 (Chr11:33450781..33452842 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378108 Chr11:33478806..33478957 No primer for this exon
upstream ENSMUSE00000339863 Chr11:33473318..33473416 No primer for this exon
upstream ENSMUSE00000101263 Chr11:33472373..33472491 No primer for this exon
upstream ENSMUSE00000101276 Chr11:33468067..33468134 No primer for this exon
upstream ENSMUSE00000101270 Chr11:33467213..33467430 No primer for this exon
upstream ENSMUSE00000101269 Chr11:33463866..33463948 No primer for this exon
upstream ENSMUSE00000101280 Chr11:33456930..33457067 No primer for this exon
upstream ENSMUSE00000101268 Chr11:33454968..33455120 No primer for this exon
upstream ENSMUSE00000101273 Chr11:33454294..33454481 No primer for this exon

*** Putative Vector Insertion (Chr 11: 33452843 - 33454293) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000408067 Chr11:33450781..33452842 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTTTGAGGGCGTTGTCTC Chr11:33454267..33454287 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTTTGAGGGCGTTGTCTC Chr11:33454267..33454287 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAGTGGATTACCCTGCCTGA Chr11:33451442..33451462 60.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGACCACGTGACTGGGAAAA Chr11:33451417..33451437 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020159