Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13990
Trapped Gene
2010003O02Rik (ENSMUSG00000028407)
Vector Insertion
Chr 4: 40216753 - 40217070
Public Clones CMHD-GT_405E7-3 (cmhd) CMHD-GT_541A11-3 (cmhd) CMHD-GT_63E10-3 (cmhd) CMHD-GT_173G12-3 (cmhd)
CMHD-GT_412H9-3 (cmhd) CMHD-GT_143H6-3 (cmhd) IST10461E5 (tigm) IST14221H6 (tigm)
Private Clones OST456641 (lexicon) OST356021 (lexicon) OST252390 (lexicon) OST11433 (lexicon)
OST11429 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178902 (Chr4:40216614..40216752 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCATGAGGCCGATGAGTC Chr4:40216704..40216723 61.04 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178902 (Chr4:40216614..40216752 +)
Downstram Exon
ENSMUSE00000178901 (Chr4:40217071..40217973 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCATGAGGCCGATGAGTC Chr4:40216704..40216723 61.04 55 GATGACGAATCCCCAAGAGA Chr4:40217115..40217134 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000178902 Chr4:40216614..40216752 TACCATGAGGCCGATGAGTC Chr4:40216704..40216723 61.04 55

*** Putative Vector Insertion (Chr 4: 40216753 - 40217070) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178901 Chr4:40217071..40217973 GATGACGAATCCCCAAGAGA Chr4:40217115..40217134 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCATGAGGCCGATGAGTC Chr4:40216705..40216725 61.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCATGAGGCCGATGAGTC Chr4:40216705..40216725 61.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028407