Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13996
Trapped Gene
Selm (ENSMUSG00000075702)
Vector Insertion
Chr 11: 3416524 - 3416844
Public Clones CMHD-GT_170A4-3 (cmhd) CMHD-GT_514H1-3 (cmhd)
Private Clones OST10042 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660063 (Chr11:3416489..3416523 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCACCGAGGACATTCAACTG Chr11:3416502..3416521 59.68 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660063 (Chr11:3416489..3416523 +)
Downstram Exon
ENSMUSE00000660062 (Chr11:3416845..3416923 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCACCGAGGACATTCAACTG Chr11:3416502..3416521 59.68 50 AGGTGCTTCATCACCAGGTT Chr11:3416871..3416890 59.58 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660047 Chr11:3414705..3415076 GATTTGGGTGGGATGTCAGT Chr11:3414791..3414810 59.64 50
upstream ENSMUSE00000660048 Chr11:3416264..3416299 CCTGTGGAGGATGACAGTTG Chr11:3416265..3416284 59.1 55
upstream ENSMUSE00000660063 Chr11:3416489..3416523 TCACCGAGGACATTCAACTG Chr11:3416502..3416521 59.68 50

*** Putative Vector Insertion (Chr 11: 3416524 - 3416844) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000660062 Chr11:3416845..3416923 AGGTGCTTCATCACCAGGTT Chr11:3416871..3416890 59.58 50
downstream ENSMUSE00000660049 Chr11:3417005..3417353 GAGCGCTTCATTCTGTCTCC Chr11:3417230..3417249 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTCACCGAGGACATTCAA Chr11:3416500..3416520 60.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTCACCGAGGACATTCAA Chr11:3416500..3416520 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075702