Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14000
Trapped Gene
1600029I14Rik (ENSMUSG00000046242)
Vector Insertion
Chr 9: 99371346 - 99374812
Public Clones CMHD-GT_167D8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363557 (Chr9:99370859..99371345 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATATTGCTGCACGAGAGG Chr9:99370955..99370974 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363557 (Chr9:99370859..99371345 +)
Downstram Exon
ENSMUSE00000411436 (Chr9:99374813..99375170 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATATTGCTGCACGAGAGG Chr9:99370955..99370974 59.97 50 AGGTTACACCATGCCTCAGC Chr9:99375119..99375138 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363557 Chr9:99370859..99371345 TCATATTGCTGCACGAGAGG Chr9:99370955..99370974 59.97 50

*** Putative Vector Insertion (Chr 9: 99371346 - 99374812) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411436 Chr9:99374813..99375170 AGGTTACACCATGCCTCAGC Chr9:99375119..99375138 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAGCACCATCGCTTACT Chr9:99374371..99374391 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGAGCACCATCGCTTACT Chr9:99374371..99374391 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046242