Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14004
Trapped Gene
4930579G22Rik (ENSMUSG00000025535)
Vector Insertion
Chr 5: 130384792 - 130386767
Public Clones CMHD-GT_125.1H12-3 (cmhd) CMHD-GT_156E3-3 (cmhd)
Private Clones OST81038 (lexicon) OST52295 (lexicon) OST24990 (lexicon) OST23195 (lexicon)
OST16901 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398385 (Chr5:130384649..130384791 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCGCAGATACTGCTCAAC Chr5:130384691..130384710 62.48 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398385 (Chr5:130384649..130384791 +)
Downstram Exon
ENSMUSE00000397811 (Chr5:130386768..130386816 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCGCAGATACTGCTCAAC Chr5:130384691..130384710 62.48 55 GGCAGGACTCCAACTCAAGA Chr5:130386808..130386827 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687419 Chr5:130384435..130384791 GGCTTCGAAGAGGAGGTGTA Chr5:130384543..130384562 59.43 55
upstream ENSMUSE00000395036 Chr5:130384462..130384647 GGCTTCGAAGAGGAGGTGTA Chr5:130384543..130384562 59.43 55
upstream ENSMUSE00000398385 Chr5:130384649..130384791 TGGCGCAGATACTGCTCAAC Chr5:130384691..130384710 62.48 55

*** Putative Vector Insertion (Chr 5: 130384792 - 130386767) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397811 Chr5:130386768..130386816 GGCAGGACTCCAACTCAAGA Chr5:130386808..130386827 60.39 55
downstream ENSMUSE00000687418 Chr5:130386768..130386816 GGCAGGACTCCAACTCAAGA Chr5:130386808..130386827 60.39 55
downstream ENSMUSE00000687417 Chr5:130386955..130387150 GCACGGAGGATCTTGGTTAC Chr5:130387014..130387033 59.56 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGGTGTTGGGTAGGGAGT Chr5:130384812..130384832 58.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGGTGTTGGGTAGGGAGT Chr5:130384812..130384832 58.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025535