Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14005
Trapped Gene
AC102115.11 (ENSMUSG00000074506)
Vector Insertion
Chr 3: 87011798 - 87011798
Public Clones CMHD-GT_156C8-3 (cmhd) CMHD-GT_117C3-3 (cmhd)
Private Clones OST445189 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638560 (Chr3:87011799..87011927 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTGAAGAGATCCGCAAA Chr3:87011880..87011899 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638560 (Chr3:87011799..87011927 -)
Downstram Exon
ENSMUSE00000638559 (Chr3:87011615..87011797 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTGAAGAGATCCGCAAA Chr3:87011880..87011899 60.1 45 TGTGATCTTGGGTGGTTTGA Chr3:87011699..87011718 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638560 Chr3:87011799..87011927 AGCTTGAAGAGATCCGCAAA Chr3:87011880..87011899 60.1 45

*** Putative Vector Insertion (Chr 3: 87011798 - 87011798) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638559 Chr3:87011615..87011797 TGTGATCTTGGGTGGTTTGA Chr3:87011699..87011718 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAACCTAATCGCCTTGCAG Chr3:87011782..87011802 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAGGGCTTATTGTTCCTG Chr3:87011802..87011822 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074506