Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14008
Trapped Gene
Gm1631 (ENSMUSG00000064263)
Vector Insertion
Chr 2: 71568406 - 71568490
Public Clones CMHD-GT_156B2-3 (cmhd)
Private Clones OST453861 (lexicon) OST442601 (lexicon) OST98119 (lexicon) OST75515 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506080 (Chr2:71568407..71568490 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTCTAGCCTGGTGTTGGA Chr2:71568452..71568471 59.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506080 (Chr2:71568407..71568490 +)
Downstram Exon
ENSMUSE00000690501 (Chr2:71568407..71568489 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTCTAGCCTGGTGTTGGA Chr2:71568452..71568471 59.29 50 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690502 Chr2:71557446..71557565 AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55
upstream ENSMUSE00000492955 Chr2:71557474..71557565 AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55
upstream ENSMUSE00000503171 Chr2:71561347..71561553 CAAGCTCAAGCAGCAATCAG Chr2:71561353..71561372 59.89 50

*** Putative Vector Insertion (Chr 2: 71568406 - 71568490) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506080 Chr2:71568407..71568490 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50
downstream ENSMUSE00000690501 Chr2:71568407..71568489 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50
downstream ENSMUSE00000690500 Chr2:71568766..71569023 TTGCATATTCCACTCGCTTG Chr2:71568854..71568873 59.83 45
downstream ENSMUSE00000690503 Chr2:71568767..71568955 TTGCATATTCCACTCGCTTG Chr2:71568854..71568873 59.83 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACACAGGTGTGTGGCTTTTC Chr2:71568370..71568391 60.07 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTACAACCCAGGGAAAT Chr2:71568426..71568446 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064263