Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1401
Trapped Gene
Dapk3 (ENSMUSG00000034974)
Vector Insertion
Chr 10: 80655088 - 80655170
Public Clones CH0873 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000302754 (Chr10:80655042..80655087 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000302754 (Chr10:80655042..80655087 +)
Downstram Exon
ENSMUSE00000302750 (Chr10:80655171..80655729 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGACTTGAGGCTGTACTCG Chr10:80655258..80655277 59.87 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349168 Chr10:80646663..80646820 CATGTCCACATTCAGGCAAG Chr10:80646758..80646777 60.11 50
upstream ENSMUSE00000302799 Chr10:80652684..80653044 AAGGAGTCATTGACGGAGGA Chr10:80652943..80652962 59.65 50
upstream ENSMUSE00000302787 Chr10:80653127..80653256 AGCTCATCGACTTTGGCATC Chr10:80653176..80653195 60.37 50
upstream ENSMUSE00000574672 Chr10:80653343..80653391 No primer for this exon
upstream ENSMUSE00000302769 Chr10:80653787..80653813 TTGGCGTCATCACCTACATC Chr10:80653792..80653811 59.53 50
upstream ENSMUSE00000302762 Chr10:80654504..80654656 GCTGACGAACATCTCAGCAG Chr10:80654549..80654568 59.73 55
upstream ENSMUSE00000302754 Chr10:80655042..80655087 No primer for this exon

*** Putative Vector Insertion (Chr 10: 80655088 - 80655170) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302750 Chr10:80655171..80655729 GGGACTTGAGGCTGTACTCG Chr10:80655258..80655277 59.87 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCAAGGTGAGGCTTCTGG Chr10:80655082..80655102 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCAAGGTGAGGCTTCTGG Chr10:80655082..80655102 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034974