Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14011
Trapped Gene
Ceacam13 (ENSMUSG00000057195)
Vector Insertion
Chr 7: 18598838 - 18604430
Public Clones CMHD-GT_162D10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479364 (Chr7:18598397..18598837 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTACGCAATGATGGGTCCTT Chr7:18598633..18598652 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479364 (Chr7:18598397..18598837 +)
Downstram Exon
ENSMUSE00000676930 (Chr7:18604431..18604569 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTACGCAATGATGGGTCCTT Chr7:18598633..18598652 59.82 50 TCAAGGGCCATGGTTTACAT Chr7:18604490..18604509 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000469969 Chr7:18595238..18595382 GCACTGGAGCTGAAGCTTTT Chr7:18595260..18595279 59.76 50
upstream ENSMUSE00000718666 Chr7:18595238..18595382 GCACTGGAGCTGAAGCTTTT Chr7:18595260..18595279 59.76 50
upstream ENSMUSE00000676932 Chr7:18595243..18595382 GCACTGGAGCTGAAGCTTTT Chr7:18595260..18595279 59.76 50
upstream ENSMUSE00000467035 Chr7:18596420..18596779 CTGCACCGTTCAAGTGTTGT Chr7:18596567..18596586 59.79 50
upstream ENSMUSE00000479364 Chr7:18598397..18598837 GTACGCAATGATGGGTCCTT Chr7:18598633..18598652 59.82 50
upstream ENSMUSE00000676931 Chr7:18598397..18598756 GTACGCAATGATGGGTCCTT Chr7:18598633..18598652 59.82 50

*** Putative Vector Insertion (Chr 7: 18598838 - 18604430) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676929 Chr7:18604431..18604570 TCAAGGGCCATGGTTTACAT Chr7:18604490..18604509 60.19 45
downstream ENSMUSE00000676930 Chr7:18604431..18604569 TCAAGGGCCATGGTTTACAT Chr7:18604490..18604509 60.19 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTTAATCGCCTTGCAGCAC Chr7:18601885..18601906 60.41 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCATTTAGTCGTGACTGG Chr7:18601878..18601898 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057195