Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14013
Trapped Gene
Scpep1 (ENSMUSG00000000278)
Vector Insertion
Chr 11: 88786039 - 88790478
Public Clones CMHD-GT_166D7-3 (cmhd) CMHD-GT_451G2-3 (cmhd) CMHD-GT_134D9-3 (cmhd) CMHD-GT_470A9-3 (cmhd)
Private Clones OST436143 (lexicon) OST409060 (lexicon) OST361940 (lexicon) OST350555 (lexicon)
OST320745 (lexicon) OST270414 (lexicon) OST252059 (lexicon) OST41371 (lexicon)
OST27933 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000106538 (Chr11:88790479..88790642 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000106538 (Chr11:88790479..88790642 -)
Downstram Exon
ENSMUSE00000403249 (Chr11:88785336..88786038 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402217 Chr11:88816608..88816743 No primer for this exon
upstream ENSMUSE00000106548 Chr11:88813720..88813868 No primer for this exon
upstream ENSMUSE00000264368 Chr11:88808459..88808548 No primer for this exon
upstream ENSMUSE00000106542 Chr11:88805689..88805844 No primer for this exon
upstream ENSMUSE00000264351 Chr11:88805111..88805185 No primer for this exon
upstream ENSMUSE00000264342 Chr11:88802598..88802670 No primer for this exon
upstream ENSMUSE00000264333 Chr11:88798328..88798365 No primer for this exon
upstream ENSMUSE00000264326 Chr11:88797137..88797265 No primer for this exon
upstream ENSMUSE00000106544 Chr11:88795892..88795985 No primer for this exon
upstream ENSMUSE00000106539 Chr11:88794762..88794875 No primer for this exon
upstream ENSMUSE00000106541 Chr11:88791522..88791659 No primer for this exon
upstream ENSMUSE00000106538 Chr11:88790479..88790642 No primer for this exon

*** Putative Vector Insertion (Chr 11: 88786039 - 88790478) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403249 Chr11:88785336..88786038 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr11:88787410..88787430 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGGTCACATGGTGAGTGAT Chr11:88787468..88787488 61.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000278