Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14032
Trapped Gene
Nufip2 (ENSMUSG00000037857)
Vector Insertion
Chr 11: 77524260 - 77555187
Public Clones CMHD-GT_444A11-3 (cmhd) CMHD-GT_152D6-3 (cmhd) CMHD-GT_396F11-3 (cmhd) CMHD-GT_459A10-3 (cmhd)
IST13660G10 (tigm) IST11091H11 (tigm) IST11509G3 (tigm) IST12571C4 (tigm)
IST11509G3 (tigm) IST11669H10 (tigm) IST13754C10 (tigm) IST12719A5BBF1 (tigm)
IST14333G7 (tigm) IST14830B8 (tigm) IST12108G2 (tigm)
Private Clones OST468110 (lexicon) OST428663 (lexicon) OST416687 (lexicon) OST415240 (lexicon)
OST403521 (lexicon) OST389807 (lexicon) OST369988 (lexicon) OST368765 (lexicon)
OST368757 (lexicon) OST328628 (lexicon) OST315882 (lexicon) OST315014 (lexicon)
OST309396 (lexicon) OST308118 (lexicon) OST283755 (lexicon) OST257947 (lexicon)
OST250475 (lexicon) OST237135 (lexicon) OST230380 (lexicon) OST204553 (lexicon)
OST120742 (lexicon) OST120728 (lexicon) OST120723 (lexicon) OST120683 (lexicon)
OST120677 (lexicon) OST106648 (lexicon) OST86079 (lexicon) OST83727 (lexicon)
OST76248 (lexicon) OST67033 (lexicon) OST67032 (lexicon) OST31755 (lexicon)
OST31580 (lexicon) OST31385 (lexicon) OST29504 (lexicon) OST28563 (lexicon)
OST27974 (lexicon) OST27220 (lexicon) OST25971 (lexicon) OST24884 (lexicon)
OST23248 (lexicon) OST19448 (lexicon) OST18018 (lexicon) OST17481 (lexicon)
OST17367 (lexicon) OST16683 (lexicon) OST14634 (lexicon) OST14454 (lexicon)
OST14433 (lexicon) OST13002 (lexicon) OST12287 (lexicon) OST11886 (lexicon)
OST9649 (lexicon) OST8607 (lexicon) OST5312 (lexicon) OST3548 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000650373 (Chr11:77523185..77524259 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATTAGAGCCACCGTTCAT Chr11:77523271..77523290 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000650373 (Chr11:77523185..77524259 +)
Downstram Exon
ENSMUSE00000650374 (Chr11:77555188..77555294 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATTAGAGCCACCGTTCAT Chr11:77523271..77523290 60.1 50 ACCAATGTAACGCCAGTTCC Chr11:77555292..77555311 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000292202 Chr11:77499641..77500009 AGCAGCCTCACCAATACCTG Chr11:77499887..77499906 60.28 55
upstream ENSMUSE00000292192 Chr11:77505044..77506756 GAACTCCTCCGTGTCACCAT Chr11:77505876..77505895 59.97 55
upstream ENSMUSE00000292185 Chr11:77519011..77519043 No primer for this exon
upstream ENSMUSE00000650373 Chr11:77523185..77524259 GCATTAGAGCCACCGTTCAT Chr11:77523271..77523290 60.1 50

*** Putative Vector Insertion (Chr 11: 77524260 - 77555187) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650374 Chr11:77555188..77555294 ACCAATGTAACGCCAGTTCC Chr11:77555292..77555311 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGCCAGTGTAATCGCCTTG Chr11:77554301..77554322 60.27 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATTCCAAAACTCAGAACCA Chr11:77527286..77527307 59.96 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037857