Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14034
Trapped Gene
Ugdh (ENSMUSG00000029201)
Vector Insertion
Chr 5: 65805303 - 65808063
Public Clones CMHD-GT_542D11-3 (cmhd) CMHD-GT_541B5-5S (cmhd) CMHD-GT_411E5-3 (cmhd) CMHD-GT_541B8-3 (cmhd)
CMHD-GT_541G5-5S (cmhd) (cmhd) CMHD-GT_542D11-3S (cmhd) CMHD-GT_377G2-3 (cmhd)
CMHD-GT_541B5-3 (cmhd) CMHD-GT_541B8-5S (cmhd) CMHD-GT_152A10-3 (cmhd) CMHD-GT_541G5-3 (cmhd)
IST14862C3 (tigm)
Private Clones OST450374 (lexicon) OST128986 (lexicon) OST16930 (lexicon) OST15151 (lexicon)
OST14759 (lexicon) OST11361 (lexicon) OST1342 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186836 (Chr5:65808064..65808174 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTACAGACCATTGGCTTCC Chr5:65808066..65808085 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186836 (Chr5:65808064..65808174 -)
Downstram Exon
ENSMUSE00000719100 (Chr5:65804441..65805302 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTACAGACCATTGGCTTCC Chr5:65808066..65808085 59.7 55 CGGAATCTCACCAGGAGTGT Chr5:65805218..65805237 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000186838 Chr5:65826863..65827117 TTCCCCGGCAGAAGTATTTA Chr5:65826992..65827011 59.54 45
upstream ENSMUSE00000708497 Chr5:65826863..65826970 GTGTCCCTGCTTTGGAAGTG Chr5:65826864..65826883 60.69 55
upstream ENSMUSE00000186828 Chr5:65818655..65818823 ATCAGGGTTACGGTTGTGGA Chr5:65818710..65818729 60.23 50
upstream ENSMUSE00000713325 Chr5:65818655..65818823 ATCAGGGTTACGGTTGTGGA Chr5:65818710..65818729 60.23 50
upstream ENSMUSE00000186841 Chr5:65815281..65815382 CGAATCCTGTCGAGGAAAAA Chr5:65815343..65815362 60.18 45
upstream ENSMUSE00000186826 Chr5:65814689..65814889 TGTCACGGAGAAAAGCACAG Chr5:65814760..65814779 60.03 50
upstream ENSMUSE00000186835 Chr5:65814400..65814597 ATTGGAGGGGATGAAACTCC Chr5:65814506..65814525 60.13 50
upstream ENSMUSE00000186831 Chr5:65813874..65814021 CAGAGGATCAGCAGCATCAA Chr5:65813981..65814000 60.1 50
upstream ENSMUSE00000186837 Chr5:65811488..65811582 CTGAATCTGCCCGAAGTAGC Chr5:65811504..65811523 59.98 55
upstream ENSMUSE00000254523 Chr5:65809717..65809847 AGGTTTGCATCACGGATCAT Chr5:65809798..65809817 60.35 45
upstream ENSMUSE00000186840 Chr5:65808750..65808883 CTTTCTCATCCGGGTGTCTC Chr5:65808764..65808783 59.65 55
upstream ENSMUSE00000186832 Chr5:65808260..65808351 TTCCAAGGACCCATACGAAG Chr5:65808313..65808332 59.93 50
upstream ENSMUSE00000186836 Chr5:65808064..65808174 GCTACAGACCATTGGCTTCC Chr5:65808066..65808085 59.7 55

*** Putative Vector Insertion (Chr 5: 65805303 - 65808063) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000361457 Chr5:65804465..65805302 CGGAATCTCACCAGGAGTGT Chr5:65805218..65805237 60.11 55
downstream ENSMUSE00000719100 Chr5:65804441..65805302 CGGAATCTCACCAGGAGTGT Chr5:65805218..65805237 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCCCTCTTACCTGGGATA Chr5:65805170..65805190 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCCCTCTTACCTGGGATA Chr5:65805170..65805190 59.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029201