Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14036
Trapped Gene
Anapc5 (ENSMUSG00000029472)
Vector Insertion
Chr 5: 123237739 - 123238028
Public Clones CMHD-GT_149C3-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000537626 (Chr5:123237740..123238027 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCCTTGATTAACCACCTC Chr5:123237819..123237838 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000537626 (Chr5:123237740..123238027 -)
Downstram Exon
ENSMUSE00000363961 (Chr5:123237740..123238027 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCCTTGATTAACCACCTC Chr5:123237819..123237838 59.93 50 ATGGCACAATGGTTCCTCTC Chr5:123237858..123237877 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000537625 Chr5:123270989..123271289 GACTGGGTGACGCCCTATAA Chr5:123271095..123271114 59.96 55
upstream ENSMUSE00000189217 Chr5:123269617..123269696 CCTCAGCTGGCAAATTCAGT Chr5:123269626..123269645 60.4 50
upstream ENSMUSE00000189215 Chr5:123268863..123268972 AGGCGAACTGAAGGATATGG Chr5:123268935..123268954 59.15 50
upstream ENSMUSE00000189216 Chr5:123267830..123268013 TATGGACCGAGAGGATGGAG Chr5:123267870..123267889 60.03 55
upstream ENSMUSE00000189219 Chr5:123264558..123264624 GTGGTCCTCTGTCCCAAAAA Chr5:123264585..123264604 59.94 50
upstream ENSMUSE00000390362 Chr5:123257309..123257410 No primer for this exon
upstream ENSMUSE00000537622 Chr5:123256283..123256444 GAGCCTGAGATACGCTGCTC Chr5:123256291..123256310 60.27 60
upstream ENSMUSE00000537620 Chr5:123256254..123256280 No primer for this exon
upstream ENSMUSE00000537645 Chr5:123256254..123256444 GAGCGGAGGGCAAAAGTAAT Chr5:123256331..123256350 60.58 50
upstream ENSMUSE00000502536 Chr5:123252832..123252913 TCCAACGATCACGTGTGTCT Chr5:123252845..123252864 60.16 50
upstream ENSMUSE00000537642 Chr5:123252832..123252913 TCCAACGATCACGTGTGTCT Chr5:123252845..123252864 60.16 50
upstream ENSMUSE00000506123 Chr5:123252139..123252228 TGCTGGAGCACTCTGTGAAG Chr5:123252163..123252182 60.33 55
upstream ENSMUSE00000537641 Chr5:123252139..123252228 TGCTGGAGCACTCTGTGAAG Chr5:123252163..123252182 60.33 55
upstream ENSMUSE00000505228 Chr5:123250460..123250641 AAGACGGCCAACAAACTGAT Chr5:123250568..123250587 59.6 45
upstream ENSMUSE00000537639 Chr5:123250460..123250641 AAGACGGCCAACAAACTGAT Chr5:123250568..123250587 59.6 45
upstream ENSMUSE00000475386 Chr5:123249348..123249483 GGGTGTGCAGCAGAACAATA Chr5:123249401..123249420 59.72 50
upstream ENSMUSE00000537638 Chr5:123249348..123249483 GGGTGTGCAGCAGAACAATA Chr5:123249401..123249420 59.72 50
upstream ENSMUSE00000474501 Chr5:123244426..123244500 GCACTTGAAGGACCGATTTC Chr5:123244449..123244468 59.68 50
upstream ENSMUSE00000537636 Chr5:123244426..123244500 GCACTTGAAGGACCGATTTC Chr5:123244449..123244468 59.68 50
upstream ENSMUSE00000469515 Chr5:123243446..123243567 TCACAGCGCTTAATGGCATA Chr5:123243460..123243479 60.38 45
upstream ENSMUSE00000537634 Chr5:123243446..123243567 TCACAGCGCTTAATGGCATA Chr5:123243460..123243479 60.38 45
upstream ENSMUSE00000468577 Chr5:123241836..123241943 TACTGCAGGCTCAGAACCAA Chr5:123241913..123241932 59.59 50
upstream ENSMUSE00000537631 Chr5:123241836..123241943 TACTGCAGGCTCAGAACCAA Chr5:123241913..123241932 59.59 50
upstream ENSMUSE00000471257 Chr5:123241617..123241764 TACTTGGCCTCCGAAACTGT Chr5:123241639..123241658 59.73 50
upstream ENSMUSE00000537600 Chr5:123241617..123241764 TACTTGGCCTCCGAAACTGT Chr5:123241639..123241658 59.73 50
upstream ENSMUSE00000470352 Chr5:123238311..123238473 GGAACAGGCCTTAACCCTTC Chr5:123238437..123238456 59.94 55
upstream ENSMUSE00000537628 Chr5:123238311..123238473 GGAACAGGCCTTAACCCTTC Chr5:123238437..123238456 59.94 55
upstream ENSMUSE00000363961 Chr5:123237740..123238027 TGCCCTTGATTAACCACCTC Chr5:123237819..123237838 59.93 50
upstream ENSMUSE00000537626 Chr5:123237740..123238027 TGCCCTTGATTAACCACCTC Chr5:123237819..123237838 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCTGCCATTCAGAACCT Chr5:123238001..123238021 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCTGCCATTCAGAACCT Chr5:123238001..123238021 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029472