Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14039
Trapped Gene
Morn5 (ENSMUSG00000026894)
Vector Insertion
Chr 2: 35912671 - 35935034
Public Clones CMHD-GT_153C4-3 (cmhd) CMHD-GT_362E4-3 (cmhd)
Private Clones OST249491 (lexicon) OST27225 (lexicon) OST27168 (lexicon) OST27164 (lexicon)
OST22308 (lexicon) OST18904 (lexicon) OST16763 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000163924 (Chr2:35912539..35912670 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCTGGGCTACTATGACTG Chr2:35912580..35912599 59.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000163924 (Chr2:35912539..35912670 +)
Downstram Exon
ENSMUSE00000387937 (Chr2:35935035..35935227 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCTGGGCTACTATGACTG Chr2:35912580..35912599 59.57 60 GCAGGTCCTGACAATCCACT Chr2:35935072..35935091 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371426 Chr2:35904993..35905095 CATAGTGACGCCAAGACAGC Chr2:35904995..35905014 59.47 55
upstream ENSMUSE00000257467 Chr2:35908457..35908604 AGATGAAGGACGGCATGTTC Chr2:35908510..35908529 60.08 50
upstream ENSMUSE00000163922 Chr2:35910481..35910592 GATCTGCTATGGCCTGAAGC Chr2:35910567..35910586 59.95 55
upstream ENSMUSE00000163924 Chr2:35912539..35912670 CCCCTGGGCTACTATGACTG Chr2:35912580..35912599 59.57 60

*** Putative Vector Insertion (Chr 2: 35912671 - 35935034) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000387937 Chr2:35935035..35935227 GCAGGTCCTGACAATCCACT Chr2:35935072..35935091 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCAGGGTCATCAAGGATT Chr2:35927625..35927645 58.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCAGGGTCATCAAGGATT Chr2:35927625..35927645 58.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026894