Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14043
Trapped Gene
C530008M07Rik (ENSMUSG00000032358)
Vector Insertion
Chr 9: 76350990 - 76393146
Public Clones CMHD-GT_129G1-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337265 (Chr9:76393147..76393653 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTAGGCTGGCCATACGTG Chr9:76393258..76393277 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337265 (Chr9:76393147..76393653 -)
Downstram Exon
ENSMUSE00000219038 (Chr9:76350825..76350989 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTAGGCTGGCCATACGTG Chr9:76393258..76393277 60.12 55 TTCCTCGTGTTGATGCCTCT Chr9:76350892..76350911 60.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337265 Chr9:76393147..76393653 ATCTAGGCTGGCCATACGTG Chr9:76393258..76393277 60.12 55

*** Putative Vector Insertion (Chr 9: 76350990 - 76393146) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219038 Chr9:76350825..76350989 TTCCTCGTGTTGATGCCTCT Chr9:76350892..76350911 60.8 50
downstream ENSMUSE00000219043 Chr9:76349916..76350040 TTTTCCGTGGAATTTTGCTC Chr9:76349950..76349969 60.05 40
downstream ENSMUSE00000635446 Chr9:76337861..76340892 AAGTGGCGGATTGTACTTGG Chr9:76340481..76340500 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:76381076..76381096 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTGTTGCTAGCCATCTT Chr9:76381165..76381185 59.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032358