Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14054
Trapped Gene
Msmb (ENSMUSG00000021907)
Vector Insertion
Chr 14: 32963452 - 32971252
Public Clones CMHD-GT_112F2-3 (cmhd) CMHD-GT_399F7-3 (cmhd) CMHD-GT_241C3-3 (cmhd) CMHD-GT_361F2-3 (cmhd)
CMHD-GT_143G3-3 (cmhd)
Private Clones OST471218 (lexicon) OST450803 (lexicon) OST252103 (lexicon) OST109594 (lexicon)
OST67541 (lexicon) OST29243 (lexicon) OST29148 (lexicon) OST28460 (lexicon)
OST28287 (lexicon) OST27692 (lexicon) OST23814 (lexicon) OST22661 (lexicon)
OST20496 (lexicon) OST19372 (lexicon) OST12572 (lexicon) OST12311 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000121898 (Chr14:32963349..32963451 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGCACGTGGTGTTCATGT Chr14:32963403..32963422 60.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000121898 (Chr14:32963349..32963451 +)
Downstram Exon
ENSMUSE00000393571 (Chr14:32971253..32971513 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGCACGTGGTGTTCATGT Chr14:32963403..32963422 60.08 50 TTCCGATCCACCACACTGTA Chr14:32971342..32971361 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690095 Chr14:32955241..32955260 No primer for this exon
upstream ENSMUSE00000121897 Chr14:32961262..32961367 TTGGCTGGGCAGTCTCTTAT Chr14:32961267..32961286 59.84 50
upstream ENSMUSE00000121898 Chr14:32963349..32963451 ACTGCACGTGGTGTTCATGT Chr14:32963403..32963422 60.08 50

*** Putative Vector Insertion (Chr 14: 32963452 - 32971252) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393571 Chr14:32971253..32971513 TTCCGATCCACCACACTGTA Chr14:32971342..32971361 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTCAATCACCTGCTGTACC Chr14:32969430..32969451 60.05 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTATTGCTTGTGGGCTGTT Chr14:32966436..32966456 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021907