Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14064
Trapped Gene
Zbtb38 (ENSMUSG00000040433)
Vector Insertion
Chr 9: 96589449 - 96618628
Public Clones (sanger) (sanger) (sanger) (sanger) D158F06 (ggtc) D179C12 (ggtc)
D158F06 (ggtc) CMHD-GT_141.1E11-3 (cmhd) IST14012A6 (tigm) IST14415H9 (tigm)
IST11761B9 (tigm) IST14958H3 (tigm)
Private Clones OST452216 (lexicon) OST376743 (lexicon) OST367568 (lexicon) OST344898 (lexicon)
OST276362 (lexicon) OST237225 (lexicon) OST232354 (lexicon) OST188116 (lexicon)
OST177282 (lexicon) OST165203 (lexicon) OST133390 (lexicon) OST97864 (lexicon)
OST94614 (lexicon) OST58380 (lexicon) OST54784 (lexicon) OST43353 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000425871 (Chr9:96618629..96618728 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCAAGGATTTCCGAGTGA Chr9:96618679..96618698 59.53 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000425871 (Chr9:96618629..96618728 -)
Downstram Exon
ENSMUSE00000583559 (Chr9:96585842..96589448 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCAAGGATTTCCGAGTGA Chr9:96618679..96618698 59.53 45 TTCGAAGTGAGATGCTGGTG Chr9:96586395..96586414 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583560 Chr9:96631711..96632094 CTCGGCGTATGATTTTTGGT Chr9:96631836..96631855 59.96 45
upstream ENSMUSE00000425871 Chr9:96618629..96618728 AACCAAGGATTTCCGAGTGA Chr9:96618679..96618698 59.53 45

*** Putative Vector Insertion (Chr 9: 96589449 - 96618628) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583559 Chr9:96585842..96589448 TTCGAAGTGAGATGCTGGTG Chr9:96586395..96586414 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAAGGCCATCCTCTGCTCT Chr9:96597656..96597676 60.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGGCCATCCTCTGCTCT Chr9:96597656..96597676 60.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCACAAATCGCTGACCTTA Chr9:96597681..96597701 60.4 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCACAAATCGCTGACCTTA Chr9:96597681..96597701 60.4 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040433