Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14070
Trapped Gene
Hdac8 (ENSMUSG00000067567)
Vector Insertion
Chr X: 99480508 - 99502977
Public Clones CMHD-GT_140A11-3 (cmhd) CMHD-GT_415H4-3 (cmhd) CMHD-GT_107E11-3 (cmhd) CMHD-GT_478B1-3 (cmhd)
PSTVUpb17b9 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000548876 (ChrX:99502978..99503083 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCTGATTATGTGCTGGAA ChrX:99503048..99503068 59.95 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000548876 (ChrX:99502978..99503083 -)
Downstram Exon
ENSMUSE00000696398 (ChrX:99479978..99480507 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCTGATTATGTGCTGGAA ChrX:99503048..99503068 59.95 47.62 CCTTACCTCCCAGTCTGCTG ChrX:99480023..99480042 59.86 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654219 ChrX:99700293..99700698 CAGTCCCGAGTATGTCAGCA ChrX:99700325..99700344 59.85 55
upstream ENSMUSE00000721013 ChrX:99700293..99700698 CAGTCCCGAGTATGTCAGCA ChrX:99700325..99700344 59.85 55
upstream ENSMUSE00000548893 ChrX:99699738..99699790 AAGCCTATGCCCTGCATAAA ChrX:99699746..99699765 59.7 45
upstream ENSMUSE00000548892 ChrX:99695161..99695291 AGGTGATGAGGACCATCCAG ChrX:99695182..99695201 59.92 55
upstream ENSMUSE00000548889 ChrX:99693470..99693611 TAGCCATCAACTGGTCTGGA ChrX:99693490..99693509 59.24 50
upstream ENSMUSE00000548886 ChrX:99627824..99627936 CGACGGAAATTTGACCGTAT ChrX:99627859..99627878 59.82 45
upstream ENSMUSE00000548884 ChrX:99624103..99624180 GTTCTCCCCAGGATTTTTCC ChrX:99624106..99624125 59.74 50
upstream ENSMUSE00000548881 ChrX:99623454..99623562 GGGGAAAGGACGGTACTACA ChrX:99623515..99623534 58.91 55
upstream ENSMUSE00000696397 ChrX:99604280..99604304 GCCTGTTTCACCAGAACTCC ChrX:99604284..99604303 59.7 55
upstream ENSMUSE00000548879 ChrX:99600876..99601048 TATTGCCGGAGATCCAATGT ChrX:99600963..99600982 60.3 45
upstream ENSMUSE00000548877 ChrX:99597924..99598018 GGGAAAACGCTATCCTCTGA ChrX:99597940..99597959 59.27 50
upstream ENSMUSE00000548876 ChrX:99502978..99503083 GGTCCTGATTATGTGCTGGAA ChrX:99503048..99503068 59.95 47.62

*** Putative Vector Insertion (Chr X: 99480508 - 99502977) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696398 ChrX:99479978..99480507 CCTTACCTCCCAGTCTGCTG ChrX:99480023..99480042 59.86 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGCATAATCGCCTTGCAG ChrX:99499912..99499932 60.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCCAGTCCAGTGTGTGGT ChrX:99499945..99499965 61.06 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067567