Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14076
Trapped Gene
4833413D08Rik (ENSMUSG00000067998)
Vector Insertion
Chr 2: 154096034 - 154096744
Public Clones CMHD-GT_140B4-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000555185 (Chr2:154095954..154096033 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCGATGTCAAATTGATGAAA Chr2:154096010..154096030 58.95 33.33 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000555185 (Chr2:154095954..154096033 +)
Downstram Exon
ENSMUSE00000681370 (Chr2:154096745..154096977 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCGATGTCAAATTGATGAAA Chr2:154096010..154096030 58.95 33.33 CTCAGGGGTTTGCTGTCATT Chr2:154096816..154096835 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594818 Chr2:154083607..154083650 AAGCAGCTCCTGAAGACAGC Chr2:154083610..154083629 59.9 55
upstream ENSMUSE00000555211 Chr2:154085706..154085985 GGCCTAAGTCCTCCAGTCCT Chr2:154085850..154085869 59.7 60
upstream ENSMUSE00000555207 Chr2:154087640..154088144 GATGGGCTCTCCAAAATCAA Chr2:154087984..154088003 60.01 45
upstream ENSMUSE00000555205 Chr2:154088452..154088553 ATGGCATGCAAGTTCTCTCC Chr2:154088505..154088524 60.23 50
upstream ENSMUSE00000555202 Chr2:154089093..154089248 ATGACGACAATTGCTGTTGC Chr2:154089145..154089164 59.73 45
upstream ENSMUSE00000555199 Chr2:154089968..154090052 CCCAGCAATAGTGACAGCAA Chr2:154090019..154090038 59.86 50
upstream ENSMUSE00000555198 Chr2:154090400..154090457 AATCCAACTCCTGTGCCATT Chr2:154090407..154090426 59.41 45
upstream ENSMUSE00000555196 Chr2:154091195..154091265 CCAGGATCTCTCCAAAAGGA Chr2:154091228..154091247 59.21 50
upstream ENSMUSE00000555194 Chr2:154092559..154092705 AGCATTGCGGTAACCATTTC Chr2:154092631..154092650 59.97 45
upstream ENSMUSE00000555191 Chr2:154093311..154093433 AAGAACGGAGAGCACTTTGC Chr2:154093401..154093420 59.62 50
upstream ENSMUSE00000555190 Chr2:154093591..154093658 GCAGCAAGATTTCAAACTCCA Chr2:154093610..154093630 60.38 42.86
upstream ENSMUSE00000555188 Chr2:154093904..154093934 No primer for this exon
upstream ENSMUSE00000555187 Chr2:154095175..154095235 GTAGGAAAGGTGGCCTGGTC Chr2:154095205..154095224 60.88 60
upstream ENSMUSE00000555185 Chr2:154095954..154096033 TCCGATGTCAAATTGATGAAA Chr2:154096010..154096030 58.95 33.33

*** Putative Vector Insertion (Chr 2: 154096034 - 154096744) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681370 Chr2:154096745..154096977 CTCAGGGGTTTGCTGTCATT Chr2:154096816..154096835 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGATGTCAAATTGATGAAA Chr2:154096011..154096032 58.95 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCGATGTCAAATTGATGAAA Chr2:154096011..154096032 58.95 33.33 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067998