Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14077
Trapped Gene
Pmfbp1 (ENSMUSG00000031727)
Vector Insertion
Chr 8: 112065775 - 112066287
Public Clones CMHD-GT_137H7-3 (cmhd) CMHD-GT_434H4-3 (cmhd)
Private Clones OST28126 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350779 (Chr8:112065539..112065774 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAACAAACTGGAGCCTTCC Chr8:112065655..112065674 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350779 (Chr8:112065539..112065774 +)
Downstram Exon
ENSMUSE00000679622 (Chr8:112066288..112066540 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAACAAACTGGAGCCTTCC Chr8:112065655..112065674 59.71 50 CTGGTTCCGGTCAAGAAAGA Chr8:112066390..112066409 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679626 Chr8:112017927..112018007 GGTGGCTTCTCATTCTTGGA Chr8:112017976..112017995 60.19 50
upstream ENSMUSE00000331305 Chr8:112018795..112018855 TTACGAACTGCCAAGGGACT Chr8:112018826..112018845 59.73 50
upstream ENSMUSE00000326118 Chr8:112023284..112023439 CCTTGCAAGAGAACCAGCTC Chr8:112023387..112023406 60.13 55
upstream ENSMUSE00000326100 Chr8:112034433..112034681 GCAGACTTCCGACCTTCTTG Chr8:112034627..112034646 59.99 55
upstream ENSMUSE00000401941 Chr8:112037644..112037865 TAGTAAGAGCACGGGGGAGA Chr8:112037676..112037695 59.83 55
upstream ENSMUSE00000366796 Chr8:112044076..112044246 CTACACTTCTCCGTGCGTGA Chr8:112044114..112044133 60.05 55
upstream ENSMUSE00000414505 Chr8:112044823..112044933 ATCCCCCTACCTCCTCAGAA Chr8:112044893..112044912 59.89 55
upstream ENSMUSE00000358417 Chr8:112048987..112049113 CGTGGAGGAGTACCAGAACC Chr8:112049031..112049050 59.57 60
upstream ENSMUSE00000326007 Chr8:112049212..112049369 GCGTCATCGAGAAGAAGGAC Chr8:112049263..112049282 59.96 55
upstream ENSMUSE00000325990 Chr8:112051480..112051720 CGAGATCCAGAAGCTCAAGG Chr8:112051662..112051681 60.09 55
upstream ENSMUSE00000325971 Chr8:112054052..112054241 ATGCTCATCGGAAAATCGAG Chr8:112054109..112054128 60.18 45
upstream ENSMUSE00000325953 Chr8:112054385..112054538 GCTTTCGAATGCAGAGAAGG Chr8:112054433..112054452 60.1 50
upstream ENSMUSE00000325937 Chr8:112055536..112055703 AAAAGGGCTCTTGGAGGAGA Chr8:112055589..112055608 60.32 50
upstream ENSMUSE00000325924 Chr8:112055963..112056100 TCCTCACACCTGGACTCCTC Chr8:112056029..112056048 60.24 60
upstream ENSMUSE00000212369 Chr8:112059712..112059876 CTGCAGACACAGCTGGATTC Chr8:112059742..112059761 59.58 55
upstream ENSMUSE00000212374 Chr8:112060452..112060619 AGATGAAATCGCGGCTTATG Chr8:112060529..112060548 60.2 45
upstream ENSMUSE00000212372 Chr8:112060937..112061104 GGAGATGAGCAACCAGGTGT Chr8:112060963..112060982 60.12 55
upstream ENSMUSE00000212371 Chr8:112061841..112061944 TGAACAACGTGGAACAATGG Chr8:112061911..112061930 60.4 45
upstream ENSMUSE00000212378 Chr8:112062499..112062573 AAGTTGACTGGCGAAAAGGA Chr8:112062554..112062573 59.85 45
upstream ENSMUSE00000350779 Chr8:112065539..112065774 CAAACAAACTGGAGCCTTCC Chr8:112065655..112065674 59.71 50

*** Putative Vector Insertion (Chr 8: 112065775 - 112066287) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679622 Chr8:112066288..112066540 CTGGTTCCGGTCAAGAAAGA Chr8:112066390..112066409 60.22 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTCCCACTAATCGCCTTG Chr8:112065817..112065837 61.02 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGTTACCTCACTCCTCA Chr8:112065755..112065775 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031727