Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14092
Trapped Gene
Cdh11 (ENSMUSG00000031673)
Vector Insertion
Chr 8: 105203912 - 105244312
Public Clones CMHD-GT_100F1-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000580678 (Chr8:105244313..105244430 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGGTATCCAATGGGTGA Chr8:105244318..105244337 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000580678 (Chr8:105244313..105244430 -)
Downstram Exon
ENSMUSE00000460908 (Chr8:105203512..105203911 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGGTATCCAATGGGTGA Chr8:105244318..105244337 60.34 50 GAGTGGCTTTCTTTCGGATG Chr8:105203772..105203791 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000580679 Chr8:105308796..105309011 CCGACTTGTGAATGGGACTC Chr8:105308883..105308902 60.51 55
upstream ENSMUSE00000580678 Chr8:105244313..105244430 AGCAGGTATCCAATGGGTGA Chr8:105244318..105244337 60.34 50

*** Putative Vector Insertion (Chr 8: 105203912 - 105244312) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000460908 Chr8:105203512..105203911 GAGTGGCTTTCTTTCGGATG Chr8:105203772..105203791 59.81 50
downstream ENSMUSE00000491577 Chr8:105197712..105198006 TCTCCTCTCGGTCCAATGTC Chr8:105197852..105197871 60.2 55
downstream ENSMUSE00000580677 Chr8:105193953..105194072 TCCACCGAGAAATAGGGTTG Chr8:105193942..105193961 59.93 50
downstream ENSMUSE00000580676 Chr8:105191898..105192065 TTGGTTGTCCCTGAGAGTCC Chr8:105191929..105191948 60.09 55
downstream ENSMUSE00000517100 Chr8:105188504..105188691 TTCAGCTTCACCACACCATC Chr8:105188486..105188505 59.68 50
downstream ENSMUSE00000520235 Chr8:105182089..105182342 AGGCTCATCGGCATCTTCTA Chr8:105182180..105182199 59.94 50
downstream ENSMUSE00000211669 Chr8:105174523..105174659 TGCTGCGAAGACAGAGATGT Chr8:105174508..105174527 59.73 50
downstream ENSMUSE00000211670 Chr8:105171698..105171831 CTTCATAAGGGGCAGCAAAC Chr8:105171720..105171739 59.71 50
downstream ENSMUSE00000211663 Chr8:105171363..105171480 AATCTTGGTCCATTGGCTGT Chr8:105171403..105171422 59.41 45
downstream ENSMUSE00000211664 Chr8:105160828..105161079 CTCCACGTCGGGCATATACT Chr8:105161025..105161044 59.98 55
downstream ENSMUSE00000482552 Chr8:105156895..105158710 CCCTTCAACTCCACAATGCT Chr8:105156950..105156969 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGGTCAGGAAAGCCCTA Chr8:105214259..105214279 60.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGAATTTACGTGACTGGGAAA Chr8:105214248..105214271 59.53 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031673