Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14096
Trapped Gene
Neurl2 (ENSMUSG00000039873)
Vector Insertion
Chr 2: 164656488 - 164658198
Public Clones CMHD-GT_115G7-3 (cmhd) CMHD-GT_393G4-3 (cmhd) CMHD-GT_514H9-3 (cmhd) CMHD-GT_401A2-3 (cmhd)
CMHD-GT_491B2-3 (cmhd) PSTVUpb1B2 (vanderbilt)
Private Clones OST24889 (lexicon) OST22480 (lexicon) OST21089 (lexicon) OST9837 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242788 (Chr2:164658199..164658956 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTATCACACGCCACCACAAC Chr2:164658581..164658600 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242788 (Chr2:164658199..164658956 -)
Downstram Exon
ENSMUSE00000242782 (Chr2:164656233..164656487 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTATCACACGCCACCACAAC Chr2:164658581..164658600 60.03 55 CTGGATCACTAGTCGGCACA Chr2:164656428..164656447 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000242788 Chr2:164658199..164658956 CTATCACACGCCACCACAAC Chr2:164658581..164658600 60.03 55

*** Putative Vector Insertion (Chr 2: 164656488 - 164658198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242782 Chr2:164656233..164656487 CTGGATCACTAGTCGGCACA Chr2:164656428..164656447 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000039873