Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14098
Trapped Gene
Oasl2 (ENSMUSG00000029561)
Vector Insertion
Chr 5: 115356814 - 115360899
Public Clones CMHD-GT_386A1-3 (cmhd) CMHD-GT_115A7-3 (cmhd)
Private Clones OST173648 (lexicon) OST104262 (lexicon) OST14784 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000190076 (Chr5:115356672..115356813 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGTTGCACGACTGTAGGC Chr5:115356770..115356789 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000190076 (Chr5:115356672..115356813 +)
Downstram Exon
ENSMUSE00000383655 (Chr5:115360900..115362233 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGTTGCACGACTGTAGGC Chr5:115356770..115356789 60.06 55 CGTCCACGGGAGTCTAACAT Chr5:115362114..115362133 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339891 Chr5:115347516..115347871 TTCTTTCGGGAACAGTGCTT Chr5:115347800..115347819 59.85 45
upstream ENSMUSE00000190082 Chr5:115349751..115350039 GCCTGGCCTACAACATCATT Chr5:115349905..115349924 59.96 50
upstream ENSMUSE00000190073 Chr5:115351249..115351424 AAGGGCTACCCTGGTGACTT Chr5:115351308..115351327 59.99 55
upstream ENSMUSE00000190069 Chr5:115354841..115355085 CTGGATGAAGGGTTCGTAGC Chr5:115354952..115354971 59.69 55
upstream ENSMUSE00000190076 Chr5:115356672..115356813 TCTGTTGCACGACTGTAGGC Chr5:115356770..115356789 60.06 55

*** Putative Vector Insertion (Chr 5: 115356814 - 115360899) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383655 Chr5:115360900..115362233 CGTCCACGGGAGTCTAACAT Chr5:115362114..115362133 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTCTGTTGCACGACTGT Chr5:115356767..115356787 59.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTCTGTTGCACGACTGT Chr5:115356767..115356787 59.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029561