Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14099
Trapped Gene
Pigv (ENSMUSG00000043257)
Vector Insertion
Chr 4: 133218707 - 133220572
Public Clones CMHD-GT_395H5-3 (cmhd) CMHD-GT_330A10-3 (cmhd) CMHD-GT_116D9-3 (cmhd) IST11089B2 (tigm)
IST13692C2 (tigm) IST14354B3 (tigm) IST11824A6 (tigm) IST13283B4 (tigm)
IST14796A2 (tigm) IST11826H6 (tigm) IST13134H8 (tigm) IST13175D10 (tigm)
IST14219D7 (tigm) IST13194E1 (tigm) IST13411E1 (tigm) IST14851B1 (tigm)
IST10661A1 (tigm) IST11824B6 (tigm) IST12846G3 (tigm) IST14132D7 (tigm)
IST10484E4 (tigm) IST10024B12 (tigm) IST13898G2 (tigm) IST11826H6 (tigm)
IST11584H3 (tigm) IST13797B5 (tigm) IST12545D11 (tigm) IST11834C11 (tigm)
IST15093F6 (tigm)
Private Clones OST399363 (lexicon) OST285915 (lexicon) OST281997 (lexicon) OST117529 (lexicon)
OST39749 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388391 (Chr4:133220573..133221694 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACGGCTACCTTTATGAGC Chr4:133221526..133221545 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388391 (Chr4:133220573..133221694 -)
Downstram Exon
ENSMUSE00000631004 (Chr4:133217343..133218706 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACGGCTACCTTTATGAGC Chr4:133221526..133221545 59.87 55 GAAGCAGGTGAGCTGGAAAC Chr4:133218621..133218640 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435847 Chr4:133228234..133228513 TAGGCGGAGGCTGTAGAGAA Chr4:133228380..133228399 60.11 55
upstream ENSMUSE00000597676 Chr4:133225653..133225775 ATTTAGAAGCCGGAGGAAGC Chr4:133225755..133225774 59.82 50
upstream ENSMUSE00000388391 Chr4:133220573..133221694 GCACGGCTACCTTTATGAGC Chr4:133221526..133221545 59.87 55

*** Putative Vector Insertion (Chr 4: 133218707 - 133220572) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000631004 Chr4:133217343..133218706 GAAGCAGGTGAGCTGGAAAC Chr4:133218621..133218640 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCCTTAATCGCCTTGCAG Chr4:133220507..133220527 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATCCTCGTGACTGGGAAA Chr4:133220508..133220528 59.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAGGTTCTCACGCGGTTTTT Chr4:133218688..133218708 59.75 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTGGCCTCTTCCACTCCTA Chr4:133218671..133218691 59.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043257