Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1410
Trapped Gene
Eif3h (ENSMUSG00000022312)
Vector Insertion
Chr 15: 51619585 - 51621538
Public Clones CH0662 (sanger)
Private Clones OST321769 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251621 (Chr15:51621539..51621659 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATGCGCAACACCAGTAAG Chr15:51621560..51621579 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251621 (Chr15:51621539..51621659 -)
Downstram Exon
ENSMUSE00000251617 (Chr15:51619452..51619584 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATGCGCAACACCAGTAAG Chr15:51621560..51621579 59.79 50 CTCGACTCTGTCGCTGCATA Chr15:51619517..51619536 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561580 Chr15:51696884..51697010 No primer for this exon
upstream ENSMUSE00000475697 Chr15:51696872..51697029 CTGTCTGGCTGGAAACATGG Chr15:51697000..51697019 61.65 55
upstream ENSMUSE00000357273 Chr15:51674014..51674170 CGGAGGATGATGCTGACTTT Chr15:51674021..51674040 60.22 50
upstream ENSMUSE00000125475 Chr15:51630738..51630905 GGGCTGGTATCAGTCCACAT Chr15:51630825..51630844 59.81 55
upstream ENSMUSE00000125471 Chr15:51629159..51629258 AAGGACTTTTCCCCTGAAGC Chr15:51629159..51629178 59.69 50
upstream ENSMUSE00000125476 Chr15:51627934..51628083 CACGAATTGCTCAGTCTTGC Chr15:51627940..51627959 59.6 50
upstream ENSMUSE00000251621 Chr15:51621539..51621659 ACATGCGCAACACCAGTAAG Chr15:51621560..51621579 59.79 50

*** Putative Vector Insertion (Chr 15: 51619585 - 51621538) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251617 Chr15:51619452..51619584 CTCGACTCTGTCGCTGCATA Chr15:51619517..51619536 60.31 55
downstream ENSMUSE00000424372 Chr15:51618110..51618371 GCCTAAGTTTTGGGCAGTGA Chr15:51618294..51618313 60.25 50
downstream ENSMUSE00000649357 Chr15:51618110..51618366 GCCTAAGTTTTGGGCAGTGA Chr15:51618294..51618313 60.25 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACACCAGTAAGCAGCAGCA Chr15:51621550..51621570 59.66 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACACCAGTAAGCAGCAGCA Chr15:51621550..51621570 59.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022312