Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14106
Trapped Gene
Ndufb6 (ENSMUSG00000071014)
Vector Insertion
Chr 4: 40217881 - 40219842
Public Clones CMHD-GT_502A7-3 (cmhd) CMHD-GT_106H1-3 (cmhd) IST11889B9 (tigm)
Private Clones OST28539 (lexicon) OST2016 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633016 (Chr4:40219843..40219887 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTAGCTCGAAGCCCAGGATA Chr4:40219849..40219868 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633016 (Chr4:40219843..40219887 -)
Downstram Exon
ENSMUSE00000605101 (Chr4:40217696..40217880 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTAGCTCGAAGCCCAGGATA Chr4:40219849..40219868 59.94 50 GGAAAATCTCTCATTGGTGGA Chr4:40217806..40217826 58.97 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605103 Chr4:40226191..40226401 TGGAGCGATTCTGGGATAAC Chr4:40226224..40226243 60.04 50
upstream ENSMUSE00000605102 Chr4:40224686..40224778 CGTACCGCTCCAGTCTCTTC Chr4:40224749..40224768 60.01 60
upstream ENSMUSE00000633016 Chr4:40219843..40219887 TTAGCTCGAAGCCCAGGATA Chr4:40219849..40219868 59.94 50

*** Putative Vector Insertion (Chr 4: 40217881 - 40219842) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605101 Chr4:40217696..40217880 GGAAAATCTCTCATTGGTGGA Chr4:40217806..40217826 58.97 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCGAAGCCCAGGATATTT Chr4:40219844..40219864 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCGAAGCCCAGGATATTT Chr4:40219844..40219864 60.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCTCGAAGCCCAGGATATT Chr4:40219845..40219865 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCTCGAAGCCCAGGATATT Chr4:40219845..40219865 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071014