Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14116
Trapped Gene
Abhd6 (ENSMUSG00000025277)
Vector Insertion
Chr 14: 8882423 - 8887984
Public Clones CMHD-GT_114F8-3 (cmhd) IST11463F6 (tigm) IST12312G4 (tigm) IST15016H6 (tigm)
IST13008A2 (tigm) IST10114F6 (tigm) IST10816C6 (tigm) IST11430E10 (tigm)
IST11843C12 (tigm) IST11997B12 (tigm) IST12312G4 (tigm) IST11032G4 (tigm)
IST12306H1 (tigm) IST11032G4 (tigm) IST10724H11 (tigm) IST12006B11 (tigm)
IST12594E1 (tigm) IST12594E1 (tigm) IST11139C8 (tigm) IST12143B2 (tigm)
IST10496B12 (tigm) IST12122G12 (tigm) IST13885C2 (tigm) IST12143B2 (tigm)
IST11918C5 (tigm)
Private Clones OST237695 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000149480 (Chr14:8882322..8882422 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATCAAGGTCCCGACACAG Chr14:8882379..8882398 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000149480 (Chr14:8882322..8882422 +)
Downstram Exon
ENSMUSE00000149481 (Chr14:8887985..8888423 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATCAAGGTCCCGACACAG Chr14:8882379..8882398 60.11 55 CTACCGAATGGCCACAGTTT Chr14:8888075..8888094 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350253 Chr14:8835457..8835477 No primer for this exon
upstream ENSMUSE00000390530 Chr14:8860751..8860903 CAGGTGTCAACAAGGCTCAA Chr14:8860757..8860776 59.87 50
upstream ENSMUSE00000306381 Chr14:8872262..8872418 GACACAAGCCATCCATCCTT Chr14:8872348..8872367 59.93 50
upstream ENSMUSE00000149485 Chr14:8873633..8873746 TGTCCATAGTGGGGCAAGTT Chr14:8873712..8873731 60.38 50
upstream ENSMUSE00000149483 Chr14:8875208..8875340 GCCGCTTACTACCCATCTGA Chr14:8875289..8875308 60.24 55
upstream ENSMUSE00000149487 Chr14:8877982..8878139 CTCCTATGTCCGCTTCAAGG Chr14:8878109..8878128 59.83 55
upstream ENSMUSE00000149484 Chr14:8882088..8882142 TCTTGTCGATGTTCGCATTC Chr14:8882099..8882118 59.81 45
upstream ENSMUSE00000149480 Chr14:8882322..8882422 AGATCAAGGTCCCGACACAG Chr14:8882379..8882398 60.11 55

*** Putative Vector Insertion (Chr 14: 8882423 - 8887984) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000149481 Chr14:8887985..8888423 CTACCGAATGGCCACAGTTT Chr14:8888075..8888094 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCAATAATCGCCTTGCAG Chr14:8885468..8885488 60.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGATCAAGGTCCCGACACA Chr14:8885379..8885399 60.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025277