Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14117
Trapped Gene
Lama4 (ENSMUSG00000019846)
Vector Insertion
Chr 10: 38825888 - 38829693
Public Clones CMHD-GT_114C12-3 (cmhd) CMHD-GT_97H4-3 (cmhd)
Private Clones OST19036 (lexicon) OST2755 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098507 (Chr10:38825768..38825887 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098507 (Chr10:38825768..38825887 +)
Downstram Exon
ENSMUSE00000348020 (Chr10:38829694..38829987 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000417844 Chr10:38685383..38685955 No primer for this exon
upstream ENSMUSE00000098534 Chr10:38725218..38725319 No primer for this exon
upstream ENSMUSE00000098527 Chr10:38730804..38730928 No primer for this exon
upstream ENSMUSE00000098525 Chr10:38737127..38737207 No primer for this exon
upstream ENSMUSE00000098524 Chr10:38746341..38746555 No primer for this exon
upstream ENSMUSE00000098510 Chr10:38748428..38748502 No primer for this exon
upstream ENSMUSE00000098539 Chr10:38750239..38750390 No primer for this exon
upstream ENSMUSE00000098505 Chr10:38752817..38752927 No primer for this exon
upstream ENSMUSE00000098517 Chr10:38762387..38762498 No primer for this exon
upstream ENSMUSE00000098518 Chr10:38765459..38765626 No primer for this exon
upstream ENSMUSE00000098537 Chr10:38767740..38767933 No primer for this exon
upstream ENSMUSE00000098521 Chr10:38773547..38773663 No primer for this exon
upstream ENSMUSE00000098514 Chr10:38776583..38776731 No primer for this exon
upstream ENSMUSE00000098538 Chr10:38779933..38780074 No primer for this exon
upstream ENSMUSE00000098533 Chr10:38781160..38781256 No primer for this exon
upstream ENSMUSE00000098526 Chr10:38785410..38785526 No primer for this exon
upstream ENSMUSE00000098501 Chr10:38787661..38787840 No primer for this exon
upstream ENSMUSE00000098531 Chr10:38789761..38789900 No primer for this exon
upstream ENSMUSE00000098511 Chr10:38792521..38792700 No primer for this exon
upstream ENSMUSE00000098520 Chr10:38793371..38793516 No primer for this exon
upstream ENSMUSE00000098513 Chr10:38793931..38794093 No primer for this exon
upstream ENSMUSE00000098523 Chr10:38794470..38794603 No primer for this exon
upstream ENSMUSE00000098515 Chr10:38795162..38795333 No primer for this exon
upstream ENSMUSE00000098509 Chr10:38798526..38798657 No primer for this exon
upstream ENSMUSE00000098529 Chr10:38800288..38800430 No primer for this exon
upstream ENSMUSE00000098506 Chr10:38802534..38802672 No primer for this exon
upstream ENSMUSE00000315823 Chr10:38803075..38803212 No primer for this exon
upstream ENSMUSE00000098512 Chr10:38807059..38807192 No primer for this exon
upstream ENSMUSE00000098502 Chr10:38808093..38808257 No primer for this exon
upstream ENSMUSE00000098528 Chr10:38808565..38808712 No primer for this exon
upstream ENSMUSE00000098516 Chr10:38811936..38812123 No primer for this exon
upstream ENSMUSE00000098504 Chr10:38814701..38814890 No primer for this exon
upstream ENSMUSE00000098535 Chr10:38816889..38817044 No primer for this exon
upstream ENSMUSE00000098519 Chr10:38818133..38818292 No primer for this exon
upstream ENSMUSE00000098530 Chr10:38823294..38823424 No primer for this exon
upstream ENSMUSE00000098536 Chr10:38824943..38825036 No primer for this exon
upstream ENSMUSE00000098507 Chr10:38825768..38825887 No primer for this exon

*** Putative Vector Insertion (Chr 10: 38825888 - 38829693) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348020 Chr10:38829694..38829987 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGTGTTCCAGGTAAGC Chr10:38828875..38828895 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGTGTTCCAGGTAAGC Chr10:38828875..38828895 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019846